Add new symmetric matrix class and so a new trinagular number method in Sequence class. Modify constructor and the addition routine in matrix classes. Add a new property to WObjekt to store the number of operations.

.gitconfig

@@ -6,6 +6,10 @@
 	br = branch
 	ci = commit
 	mylog = log --pretty=format:'%h %s [%an]' --graph
+  lg1 = log --graph --abbrev-commit --decorate --date=relative --format=format:'%C(bold blue)%h%C(reset) - %C(bold green)(%ar)%C(reset) %C(white)%s%C(reset) %C(dim white)- %an%C(reset)%C(bold yellow)%d%C(reset)' --all
+  lg2 = log --graph --abbrev-commit --decorate --format=format:'%C(bold blue)%h%C(reset) - %C(bold cyan)%aD%C(reset) %C(bold green)(%ar)%C(reset)%C(bold yellow)%d%C(reset)%n''          %C(white)%s%C(reset) %C(dim white)- %an%C(reset)' --all
+  lg = !"git lg1"
+  changes = show --stat --oneline
 	pushall = push --recurse-submodules=on-demand
 [core]
 	quotepath = off

resources/2body.txt

@@ -0,0 +1,4 @@
+ 2 
+ 5.0e10 
+ 0.0e00  4.5e10  1.0e04 0.0e00 1.5e30 
+ 0.0e00 -4.5e10 -1.0e04 0.0e00 1.5e30 

resources/2bodyTiny.txt

@@ -0,0 +1,5 @@
+ 2 
+ 5.0e-10 
+ 0.0e00  4.5e-10  1.0e-16 0.0e00 1.5e-30 
+ 0.0e00 -4.5e-10 -1.0e-16 0.0e00 1.5e-30 
+

resources/3body.txt

@@ -0,0 +1,5 @@
+ 3 
+ 1.25e11 
+ 0.0e00  0.0e00 0.05e04 0.0e00 5.97e24 
+ 0.0e00  4.5e10  3.0e04 0.0e00 1.989e30 
+ 0.0e00 -4.5e10 -3.0e04 0.0e00 1.989e30 

resources/4body.txt

@@ -0,0 +1,6 @@
+4 
+ 5.0e10 
+-3.5e10 0.0e00 0.0e00  1.4e03 3.0e28 
+-1.0e10 0.0e00 0.0e00  1.4e04 3.0e28 
+ 1.0e10 0.0e00 0.0e00 -1.4e04 3.0e28 
+ 3.5e10 0.0e00 0.0e00 -1.4e03 3.0e28 

resources/8ints.txt

@@ -0,0 +1,9 @@
+8
+  30
+ -30
+ -20
+ -10
+  40
+   0
+  10
+  15

resources/Ascale.txt

@@ -0,0 +1,18 @@
+0  .5
+2  .5
+4  .5
+5  .5
+7  .5
+9  .5
+11 .5
+12 .5
+
+12 .5
+11 .5
+9  .5
+7  .5
+5  .5
+4  .5
+2  .5
+0  .5
+

resources/Constitution.txt

@@ -0,0 +1,998 @@
+The Project Gutenberg EBook of The United States' Constitution
+by  Founding Fathers
+
+Copyright laws are changing all over the world. Be sure to check the
+copyright laws for your country before downloading or redistributing
+this or any other Project Gutenberg eBook.
+
+This header should be the first thing seen when viewing this Project
+Gutenberg file.  Please do not remove it.  Do not change or edit the
+header without written permission.
+
+Please read the "legal small print," and other information about the
+eBook and Project Gutenberg at the bottom of this file.  Included is
+important information about your specific rights and restrictions in
+how the file may be used.  You can also find out about how to make a
+donation to Project Gutenberg, and how to get involved.
+
+
+**Welcome To The World of Free Plain Vanilla Electronic Texts**
+
+**eBooks Readable By Both Humans and By Computers, Since 1971**
+
+*****These eBooks Were Prepared By Thousands of Volunteers!*****
+
+
+Title: The United States' Constitution
+
+Author:  Founding Fathers
+
+Release Date: December, 1975  [EBook #5]
+[This file was first posted on August 19, 2003]
+[Most recently updated: August 19, 2003]
+
+Edition: 11
+
+Language: English
+
+Character set encoding: US-ASCII
+
+*** START OF THE PROJECT GUTENBERG EBOOK, THE UNITED STATES' CONSTITUTION ***
+
+
+
+
+All of the original Project Gutenberg Etexts from the
+1970's were produced in ALL CAPS, no lower case.  The
+computers we used then didn't have lower case at all.
+
+***
+
+These original Project Gutenberg Etexts will be compiled into a file
+containing them all, in order to improve the content ratios of Etext
+to header material.
+
+***
+
+
+
+The following edition of The Consitution of the United States of America
+has been based on many hours of study of a variety of editions, and will
+include certain variant spellings, punctuation, and captialization as we
+have been able to reasonable ascertain belonged to the orginal.  In case
+of internal discrepancies in these matters, most or all have been left.
+
+In our orginal editions the letters were all CAPITALS, and we did not do
+anything about capitalization, consistent or otherwise, nor with most of
+the punctuation, since we had limited punctionation in those days.
+
+This document does NOT include the amendments, as the Bill of Rights was
+one of our earlier Project Gutenberg Etexts, and the others will be sent
+in a separate posting.
+
+***
+
+We would ask that any Consitutional scholars would please take a minute,
+or longer, to send us a note concerning possible corrections.
+
+***
+
+
+
+
+THE CONSTITUTION OF THE UNITED STATES OF AMERICA, 1787
+
+
+
+We the people of the United States, in Order to form a more perfect Union,
+establish Justice, insure domestic Tranquility, provide for the common defence,
+promote the general Welfare, and secure the Blessings of Liberty to ourselves
+and our Posterity, do ordain and establish this Constitution for the
+United States of America.
+
+
+Article 1
+
+Section 1.  All legislative Powers herein granted shall be vested in a
+Congress of the United States, which shall consist of a Senate and
+House of Representatives.
+
+Section 2.  The House of Representatives shall be composed of Members
+chosen every second Year by the People of the several States,
+and the electors in each State shall have the qualifications requisite
+for electors of the most numerous branch of the State legislature.
+
+No Person shall be a Representative who shall not have attained to the
+Age of twenty five Years, and been seven Years a citizen of the United States,
+and who shall not, when elected, be an Inhabitant of that State in which
+he shall be chosen.
+
+Representatives and direct Taxes shall be apportioned among
+the several States which may be included within this Union,
+according to their respective Numbers, which shall be determined
+by adding to the whole number of free Persons, including those
+bound to Service for a Term of Years, and excluding Indians not taxed,
+three fifths of all other Persons.  The actual Enumeration shall be made
+within three Years after the first Meeting of the Congress of the
+United States, and within every subsequent Term of ten Years,
+in such Manner as they shall by law Direct.  The number of
+Representatives shall not exceed one for every thirty Thousand,
+but each State shall have at least one Representative;
+and until such enumeration shall be made, the State of New Hampshire
+shall be entitled to chuse three, Massachusetts eight, Rhode Island
+and Providence Plantations one, Connecticut five, New York six,
+New Jersey four, Pennsylvania eight, Delaware one, Maryland six,
+Virginia ten, North Carolina five, South Carolina five, and Georgia three.
+
+When vacancies happen in the Representation from any State, the Executive
+Authority thereof shall issue Writs of Election to fill such Vacancies.
+
+The House of Representatives shall chuse their Speaker and other Officers;
+and shall have the sole Power of Impeachment.
+
+Section 3.  The Senate of the United States shall be composed of
+two Senators from each State, chosen by the legislature thereof,
+for six Years; and each Senator shall have one Vote.
+
+Immediately after they shall be assembled in Consequence of the first Election,
+they shall be divided as equally as may be into three Classes.  The Seats of
+the Senators of the first Class shall be vacated at the expiration of the
+second Year, of the second Class at the expiration of the fourth Year,
+and of the third Class at the expiration of the sixth Year, so that one third
+may be chosen every second Year; and if vacancies happen by Resignation,
+or otherwise, during the recess of the Legislature of any State,
+the Executive thereof may make temporary Appointments until the
+next meeting of the Legislature, which shall then fill such Vacancies.
+
+No person shall be a Senator who shall not have attained to the Age of
+thirty Years, and been nine Years a Citizen of the United States,
+and who shall not, when elected, be an Inhabitant of that State
+for which he shall be chosen.
+
+The Vice-President of the United States shall be President of the Senate,
+but shall have no Vote, unless they be equally divided.
+
+The Senate shall choose their other Officers, and also a President
+pro tempore, in the Absence of the Vice-President, or when he shall
+exercise the Office of President of the United States.
+
+The Senate shall have the sole Power to try all Impeachments.
+When sitting for that Purpose, they shall be on Oath or Affirmation.
+When the President of the United States is tried, the Chief Justice
+shall preside: And no Person shall be convicted without the Concurrence
+of two thirds of the Members present.
+
+Judgment in cases of Impeachment shall not extend further than to removal
+from Office, and disqualification to hold and enjoy any Office of honor,
+Trust or Profit under the United States:  but the Party convicted shall
+nevertheless be liable and subject to Indictment, Trial, Judgment and
+Punishment, according to Law.
+
+Section 4.  The Times, Places and Manner of holding Elections for Senators and
+Representatives, shall be prescribed in each State by the Legislature thereof;
+but the Congress may at any time by Law make or alter such Regulations,
+except as to the Places of chusing Senators.
+
+The Congress shall assemble at least once in every Year,
+and such Meeting shall be on the first Monday in December,
+unless they shall by law appoint a different Day.
+
+
+Section 5.  Each House shall be the Judge of the Elections,
+Returns and Qualifications of its own Members, and a
+Majority of each shall constitute a Quorum to do Business;
+but a smaller Number may adjourn from day to day,
+and may be authorized to compel the Attendance of absent Members,
+in such Manner, and under such Penalties as each House may provide.
+
+Each house may determine the Rules of its Proceedings,
+punish its Members for disorderly Behavior, and, with the
+Concurrence of two-thirds, expel a Member.
+
+Each house shall keep a Journal of its Proceedings,
+and from time to time publish the same, excepting such Parts as may
+in their Judgment require Secrecy; and the Yeas and Nays of the
+Members of either House on any question shall, at the Desire of
+one fifth of those Present, be entered on the Journal.
+
+Neither House, during the Session of Congress, shall, without the
+Consent of the other, adjourn for more than three days, nor to
+any other Place than that in which the two Houses shall be sitting.
+
+Section 6.  The Senators and Representatives shall receive a Compensation
+for their Services, to be ascertained by Law, and paid out of the Treasury
+of the United States.  They shall in all Cases, except Treason, Felony and
+Breach of the Peace, be privileged from Arrest during their Attendance
+at the Session of their respective Houses, and in going to and returning
+from the same; and for any Speech or Debate in either House,
+they shall not be questioned in any other Place.
+
+No Senator or Representative shall, during the Time for which he was elected,
+be appointed to any civil Office under the authority of the United States,
+which shall have been created, or the Emoluments whereof shall have been
+increased during such time; and no Person holding any Office under the
+United States, shall be a Member of either House during his Continuance
+in Office.
+
+Section 7.  All Bills for raising Revenue shall originate in the
+House of Representatives; but the Senate may propose or concur with
+Amendments as on other Bills.
+
+Every Bill which shall have passed the House of Representatives and
+the Senate, shall, before it become a Law, be presented to the
+President of the United States; If he approve he shall sign it,
+but if not he shall return it, with his Objections to that House
+in which it shall have originated, who shall enter the Objections
+at large on their Journal, and proceed to reconsider it.
+If after such Reconsideration two thirds of that house
+shall agree to pass the Bill, it shall be sent,
+together with the Objections, to the other House, by which
+it shall likewise be reconsidered, and if approved by two thirds
+of that House, it shall become a law.  But in all such Cases
+the Votes of both Houses shall be determined by Yeas and Nays,
+and the Names of the Persons voting for and against the Bill shall be
+entered on the Journal of each House respectively.  If any Bill
+shall not be returned by the President within ten Days (Sundays excepted)
+after it shall have been presented to him, the Same shall be a Law,
+in like Manner as if he had signed it, unless the Congress by their
+Adjournment prevent its Return, in which case it shall not be a Law.
+
+Every Order, Resolution, or Vote to which the Concurrence of the Senate
+and House of Representatives may be necessary (except on a question
+of Adjournment) shall be presented to the President of the United States;
+and before the Same shall take Effect, shall be approved by him,
+or being disapproved by him, shall be repassed by two thirds of
+the Senate and House of Representatives, according to the Rules
+and Limitations prescribed in the Case of a Bill.
+
+Section 8.  The Congress shall have Power to lay and collect Taxes, Duties,
+Imposts and Excises, to pay the Debts and provide for the common Defence
+and general Welfare of the United States; but all Duties, Imposts and Excises
+shall be uniform throughout the United States;
+
+To borrow Money on the credit of the United States;
+
+To regulate Commerce with foreign Nations, and among the several States,
+and with the Indian Tribes;
+
+To establish an uniform Rule of Naturalization, and uniform Laws
+on the subject of Bankruptcies throughout the United States;
+
+To coin Money, regulate the Value thereof, and of foreign Coin,
+and fix the Standard of Weights and Measures;
+
+To provide for the Punishment of counterfeiting the Securities
+and current Coin of the United States;
+
+To establish Post Offices and Post Roads;
+
+To promote the Progress of Science and useful Arts, by securing
+for limited Times to Authors and Inventors the exclusive Right
+to their respective Writings and Discoveries;
+
+To constitute Tribunals inferior to the supreme Court;
+
+To define and punish Piracies and Felonies committed on the high Seas,
+and Offenses against the Law of Nations;
+
+To declare War, grant Letters of Marque and Reprisal,
+and make Rules concerning Captures on Land and Water;
+
+To raise and support Armies, but no Appropriation of Money to that Use
+shall be for a longer term than two Years;
+
+To provide and maintain a Navy;
+
+To make Rules for the Government and Regulation of the land and naval Forces;
+
+To provide for calling forth the Militia to execute the Laws of the Union,
+suppress Insurrections and repel Invasions;
+
+To provide for organizing, arming, and disciplining, the Militia, and for
+governing such Part of them as may be employed in the Service of the
+United States, reserving to the States respectively, the Appointment
+of the Officers, and the Authority of training the militia according
+to the discipline prescribed by Congress;
+
+To exercise exclusive Legislation in all Cases whatsoever,
+over such District (not exceeding ten Miles square) as may,
+by Cession of particular States, and the Acceptance of Congress,
+become the Seat of the Government of the United States, and to
+exercise like Authority over all Places purchased by the Consent
+of the Legislature of the State in which the Same shall be,
+for the Erection of Forts, Magazines, Arsenals, Dockyards,
+and other needful Buildings;--And
+
+To make all Laws which shall be necessary and proper for carrying
+into Execution the foregoing Powers, and all other Powers vested
+by this Constitution in the Government of the United States,
+or in any Department or Officer thereof.
+
+Section 9.  The Migration or Importation of such Persons as any
+of the States now existing shall think proper to admit, shall not
+be prohibited by the Congress prior to the Year one thousand eight
+hundred and eight, but a Tax or Duty may be imposed on such Importation,
+not exceeding ten dollars for each Person.
+
+The Privilege of the Writ of Habeas Corpus shall not be suspended, unless
+when in Cases of Rebellion or Invasion the public Safety may require it.
+
+No Bill of Attainder or ex post facto Law shall be passed.
+
+No Capitation, or other direct, Tax shall be laid, unless in Proportion
+to the Census or Enumeration herein before directed to be taken.
+
+No Tax or Duty shall be laid on Articles exported from any State.
+
+No Preference shall be given by any Regulation of Commerce or Revenue
+to the Ports of one State over those of another: nor shall Vessels bound to,
+or from, one State, be obliged to enter, clear, or pay Duties in another.
+
+No Money shall be drawn from the Treasury, but in Consequence
+of Appropriations made by Law; and a regular Statement and Account
+of the Receipts and Expenditures of all public Money shall be
+published from time to time.
+
+No Title of Nobility shall be granted by the United States;
+and no Person holding any Office of Profit or Trust under them, shall,
+without the Consent of the Congress, accept of any present, Emolument,
+Office, or Title, of any kind whatever, from any King, Prince,
+or foreign State.
+
+Section 10.  No State shall enter into any Treaty, Alliance, or
+Confederation; grant Letters of Marque and Reprisal; coin Money;
+emit Bills of Credit; make any Thing but gold and silver Coin a Tender
+in Payment of Debts; pass any Bill of Attainder, ex post facto Law,
+or Law impairing the Obligation of Contracts, or grant any Title of Nobility.
+
+No State shall, without the Consent of the Congress, lay any Imposts or Duties
+on Imports or Exports, except what may be absolutely necessary for executing
+it's inspection Laws: and the net Produce of all Duties and Imposts,
+laid by any State on Imports or Exports, shall be for the Use of the Treasury
+of the United States; and all such Laws shall be subject to the Revision
+and Controul of the Congress.
+
+
+No State shall, without the Consent of Congress, lay any Duty of
+Tonnage, keep Troops, or Ships of War in time of Peace, enter into any
+Agreement or Compact with another State, or with a foreign Power, or
+engage in War, unless actually invaded, or in such imminent Danger
+as will not admit of delay.
+
+ARTICLE 2
+
+Section 1.  The executive Power shall be vested in a President
+of the United States of America.  He shall hold his Office during
+the Term of four Years, and, together with the Vice President
+chosen for the same Term, be elected, as follows:
+
+Each State shall appoint, in such Manner as the Legislature thereof may direct,
+a Number of Electors, equal to the whole Number of Senators and Representatives
+to which the State may be entitled in the Congress:  but no Senator or
+Representative, or Person holding an Office of Trust or Profit under
+the United States, shall be appointed an Elector.
+
+The Electors shall meet in their respective States, and vote by Ballot
+for two Persons, of whom one at least shall not lie an Inhabitant of
+the same State with themselves.  And they shall make a List of
+all the Persons voted for, and of the Number of Votes for each;
+which List they shall sign and certify, and transmit sealed to
+the Seat of the Government of the United States, directed to the
+President of the Senate.  The President of the Senate shall,
+in the Presence of the Senate and House of Representatives,
+open all the Certificates, and the Votes shall then be counted.
+The Person having the greatest Number of Votes shall be the President,
+if such Number be a Majority of the whole Number of Electors appointed;
+and if there be more than one who have such Majority, and have an equal
+Number of votes, then the House of Representatives shall immediately
+chuse by Ballot one of them for President; and if no Person have
+a Majority, then from the five highest on the List the said House
+shall in like Manner chuse the President.  But in chusing the President,
+the Votes shall be taken by States, the Representation from each State
+having one Vote; a Quorum for this Purpose shall consist of a Member
+or Members from two thirds of the States, and a Majority of all the
+States shall be necessary to a Choice.  In every Case, after the Choice
+of the President, the Person having the greatest Number of Votes of
+the Electors shall be the Vice President.  But if there should remain
+two or more who have equal Votes, the Senate shall chuse from them
+by Ballot the Vice President.
+
+The Congress may determine the Time of chusing the Electors,
+and the Day on which they shall give their Votes; which Day
+shall be the same throughout the United States.
+
+No Person except a natural born Citizen, or a Citizen of the United States,
+at the time of the Adoption of this Constitution, shall be eligible to
+the Office of President; neither shall any Person be eligible to that
+Office who shall not have attained to the Age of thirty five Years,
+and been fourteen Years a Resident within the United States.
+
+In Case of the Removal of the President from Office, or of his Death,
+Resignation, or Inability to discharge the Powers and Duties of the
+said Office, the Same shall devolve on the Vice President, and the
+Congress may by Law provide for the Case of Removal, Death, Resignation
+or Inability, both of the President and Vice President, declaring what
+Officer shall then act as President, and such Officer shall act accordingly,
+until the Disability be removed, or a President shall be elected.
+
+The President shall, at stated Times, receive for his Services,
+a Compensation, which shall neither be encreased nor diminished during
+the Period for which he shall have been elected, and he shall not receive
+within that Period any other Emolument from the United States, or any of them.
+
+Before he enter on the Execution of his Office, he shall take the
+following Oath or Affirmation:--"I do solemnly swear (or affirm) that
+I will faithfully execute the Office of President of the United States,
+and will to the best of my Ability, preserve, protect and defend the
+Constitution of the United States."
+
+Section 2.  The President shall be Commander in Chief of the Army
+and Navy of the United States, and of the Militia of the several States,
+when called into the actual Service of the United States;
+he may require the Opinion, in writing, of the principal Officer
+in each of the executive Departments, upon any Subject relating to
+the Duties of their respective Offices, and he shall have Power
+to grant Reprieves and Pardons for Offenses against the United States,
+except in Cases of impeachment.
+
+He shall have Power, by and with the Advice and Consent of the
+Senate, to make Treaties, provided two thirds of the Senators
+present concur; and he shall nominate, and by and with the Advice
+and Consent of the Senate, shall appoint Ambassadors, other public
+Ministers and Consuls, Judges of the supreme Court, and all other
+Officers of the United States, whose Appointments are not herein
+otherwise provided for, and which shall be established by Law:
+but the Congress may by Law vest the Appointment of such inferior Officers,
+as they think proper, in the President alone, in the Courts of Law,
+or in the Heads of Departments.
+
+The President shall have Power to fill up all Vacancies that may happen
+during the Recess of the Senate, by granting Commissions which shall
+expire at the End of their next session.
+
+Section 3.  He shall from time to time give to the Congress
+Information of the State of the Union, and recommend to their
+Consideration such Measures as he shall judge necessary and expedient;
+he may, on extraordinary Occasions, convene both Houses, or either
+of them, and in Case of Disagreement between them, with Respect to
+the Time of Adjournment, he may adjourn them to such Time as he shall
+think proper; he shall receive Ambassadors and other public Ministers;
+he shall take Care that the Laws be faithfully executed, and shall
+Commission all the Officers of the United States.
+
+Section 4.  The President, Vice President and all civil Officers of the
+United States, shall be removed from Office on Impeachment for,
+and Conviction of, Treason, Bribery, or other high Crimes and Misdemeanors.
+
+ARTICLE THREE
+
+Section 1.  The judicial Power of the United States, shall be vested
+in one supreme Court, and in such inferior Courts as the Congress may
+from time to time ordain and establish.  The Judges, both of the supreme
+and inferior Courts, shall hold their Offices during good behavior,
+and shall, at stated Times, receive for their Services, a Compensation,
+which shall not be diminished during their Continuance in Office.
+
+Section 2.  The judicial Power shall extend to all Cases, in Law and Equity,
+arising under this Constitution, the Laws of the United States, and Treaties
+made, or which shall be made, under their Authority;--to all Cases affecting
+Ambassadors, other public Ministers and Consuls;--to all Cases of admiralty
+and maritime Jurisdiction;--to Controversies to which the United States
+shall be a Party;--to Controversies between two or more States;--between a
+State and Citizens of another State;--between Citizens of different States;
+--between Citizens of the same State claiming Lands under Grants of
+different States, and between a State, or the Citizens thereof,
+and foreign States, Citizens or Subjects.
+
+In all cases affecting Ambassadors, other public Ministers and Consuls,
+and those in which a State shall be Party, the supreme Court shall have
+original Jurisdiction.  In all the other Cases before mentioned, the
+supreme Court shall have appellate Jurisdiction, both as to Law and Fact,
+with such Exceptions, and under such Regulations as the Congress shall make.
+
+The Trial of all Crimes, except in Cases of Impeachment, shall be by Jury;
+and such Trial shall be held in the State where the said Crimes shall
+have been committed; but when not committed within any State, the Trial
+shall be at such Place or Places as the Congress may by Law have directed.
+
+Section 3.  Treason against the United States, shall consist only in
+levying War against them, or in adhering to their Enemies, giving them
+Aid and Comfort.  No Person shall be convicted of Treason unless on
+the Testimony of two Witnesses to the same overt Act, or on Confession
+in open Court.
+
+The Congress shall have power to declare the punishment of Treason,
+but no Attainder of Treason shall work Corruption of Blood,
+or Forfeiture except during the Life of the Person attainted.
+
+
+ARTICLE FOUR
+
+Section 1.  Full Faith and Credit shall be given in each State to the
+public Acts, Records, and judicial Proceedings of every other State.
+And the Congress may by general Laws prescribe the Manner in which such Acts,
+Records, and Proceedings shall be proved, and the Effect thereof.
+
+
+Section 2.  The Citizens of each State shall be entitled to all
+Privileges and Immunities of Citizens in the several States.
+
+A Person charged in any State with Treason, Felony, or other Crime,
+who shall flee from Justice, and be found in another State,
+shall on Demand of the executive Authority of the State from
+which he fled, be delivered up, to be removed to the State having
+Jurisdiction of the Crime.
+
+No person held to Service or Labor in one State, under the Laws thereof,
+escaping into another, shall, in Consequence of any Law or Regulation therein,
+be discharged from such Service or Labor, But shall be delivered up on Claim
+of the Party to whom such Service or Labor may be due.
+
+
+Section 3.  New States may be admitted by the Congress into this Union;
+but no new States shall be formed or erected within the Jurisdiction
+of any other State; nor any State be formed by the Junction of two
+or more States, or Parts of States, without the Consent of the
+Legislatures of the States concerned as well as of the Congress.
+
+The Congress shall have Power to dispose of and make all needful Rules
+and Regulations respecting the Territory or other Property belonging
+to the United States; and nothing in this Constitution shall be so
+construed as to Prejudice any Claims of the United States,
+or of any particular State.
+
+Section 4.  The United States shall guarantee to every State in this Union
+a Republican Form of Government, and shall protect each of them against
+Invasion; and on Application of the Legislature, or of the Executive
+(when the Legislature cannot be convened) against domestic Violence.
+
+
+ARTICLE FIVE
+
+The Congress, whenever two thirds of both Houses shall deem it necessary,
+shall propose Amendments to this Constitution, or, on the Application of
+the Legislatures of two thirds of the several States, shall call a Convention
+for proposing Amendments, which, in either Case, shall be valid to all Intents
+and Purposes, as Part of this Constitution, when ratified by the Legislatures
+of three fourths of the several States, or by Conventions in three fourths
+thereof, as the one or the other Mode of Ratification may be proposed by
+the Congress; Provided that no Amendment which may be made prior to the
+Year one thousand eight hundred and eight shall in any Manner affect
+the first and fourth Clauses in the ninth Section of the first Article;
+and that no State, without its Consent, shall be deprived of it's
+equal Suffrage in the Senate.
+
+ARTICLE SIX
+
+All Debts contracted and Engagements entered into, before the Adoption
+of this Constitution, shall be as valid against the United States
+under this Constitution, as under the Confederation.
+
+This Constitution, and the Laws of the United States which shall be made
+in Pursuance thereof; and all Treaties made, or which shall be made,
+under the Authority of the United States, shall be the supreme
+Law of the Land; and the Judges in every State shall be bound thereby,
+any Thing in the Constitution or Laws of any State to the Contrary
+notwithstanding.
+
+The Senators and Representatives before mentioned, and the Members of the
+several State Legislatures, and all executive and judicial Officers,
+both of the United States and of the several States, shall be bound
+by Oath or Affirmation, to support this Constitution; but no religious
+Test shall ever be required as a Qualification to any Office or public Trust
+under the United States
+
+ARTICLE SEVEN
+
+The Ratification of the Conventions of nine States, shall be sufficient for the
+Establishment of this Constitution between the States so ratifying the Same.
+
+Done in Convention by the Unanimous Consent of the States present
+the Seventeenth Day of September in the Year of our Lord one
+thousand seven hundred and eighty seven and of the Independence of the
+United States of America the Twelfth        In Witness whereof We have
+hereunto subscribed our Names,
+
+Go. WASHINGTON--
+Presid. and deputy from Virginia
+
+New Hampshire
+
+John Langdon
+Nicholas Gilman
+
+Massachusetts
+
+Nathaniel Gorham
+Rufus King
+
+Connecticut
+
+Wm. Saml. Johnson
+Roger Sherman
+
+New York
+
+Alexander Hamilton
+
+New Jersey
+
+Wil: Livingston
+David Brearley
+Wm. Paterson
+Jona: Dayton
+
+Pennsylvania
+
+B Franklin
+Thomas Mifflin
+Robt Morris
+Geo. Clymer
+Thos FitzSimons
+Jared Ingersoll
+James Wilson
+Gouv Morris
+
+Delaware
+
+Geo: Read
+Gunning Bedford jun
+John Dickinson
+Richard Bassett
+Jaco: Broom
+
+Maryland
+
+James Mchenry
+Dan of St Thos. Jenifer
+Danl Carroll
+
+Virginia
+
+John Blair--
+James Madison Jr.
+
+North Carolina
+
+Wm. Blount
+Rich'd Dobbs Spaight
+Hu Williamson
+
+South Carolina
+
+J. Rutledge
+Charles Cotesworth Pinckney
+Charles Pinckney
+Pierce Butler
+
+Georgia
+
+William Few
+Abr Baldwin
+
+
+Attest:
+William Jackson, Secretary
+
+
+
+
+
+
+*** END OF THE PROJECT GUTENBERG EBOOK, THE UNITED STATES' CONSTITUTION ***
+
+This file should be named const11.txt or const11.zip
+Corrected EDITIONS of our eBooks get a new NUMBER, const12.txt
+VERSIONS based on separate sources get new LETTER, const11a.txt
+
+Project Gutenberg eBooks are often created from several printed
+editions, all of which are confirmed as Public Domain in the US
+unless a copyright notice is included.  Thus, we usually do not
+keep eBooks in compliance with any particular paper edition.
+
+We are now trying to release all our eBooks one year in advance
+of the official release dates, leaving time for better editing.
+Please be encouraged to tell us about any error or corrections,
+even years after the official publication date.
+
+Please note neither this listing nor its contents are final til
+midnight of the last day of the month of any such announcement.
+The official release date of all Project Gutenberg eBooks is at
+Midnight, Central Time, of the last day of the stated month.  A
+preliminary version may often be posted for suggestion, comment
+and editing by those who wish to do so.
+
+Most people start at our Web sites at:
+http://gutenberg.net or
+http://promo.net/pg
+
+These Web sites include award-winning information about Project
+Gutenberg, including how to donate, how to help produce our new
+eBooks, and how to subscribe to our email newsletter (free!).
+
+
+Those of you who want to download any eBook before announcement
+can get to them as follows, and just download by date.  This is
+also a good way to get them instantly upon announcement, as the
+indexes our cataloguers produce obviously take a while after an
+announcement goes out in the Project Gutenberg Newsletter.
+
+http://www.ibiblio.org/gutenberg/etext05 or
+ftp://ftp.ibiblio.org/pub/docs/books/gutenberg/etext05
+
+Or /etext04, 03, 02, 01, 00, 99, 98, 97, 96, 95, 94, 93, 92, 92,
+91 or 90
+
+Just search by the first five letters of the filename you want,
+as it appears in our Newsletters.
+
+
+Information about Project Gutenberg (one page)
+
+We produce about two million dollars for each hour we work.  The
+time it takes us, a rather conservative estimate, is fifty hours
+to get any eBook selected, entered, proofread, edited, copyright
+searched and analyzed, the copyright letters written, etc.   Our
+projected audience is one hundred million readers.  If the value
+per text is nominally estimated at one dollar then we produce $2
+million dollars per hour in 2002 as we release over 100 new text
+files per month:  1240 more eBooks in 2001 for a total of 4000+
+We are already on our way to trying for 2000 more eBooks in 2002
+If they reach just 1-2% of the world's population then the total
+will reach over half a trillion eBooks given away by year's end.
+
+The Goal of Project Gutenberg is to Give Away 1 Trillion eBooks!
+This is ten thousand titles each to one hundred million readers,
+which is only about 4% of the present number of computer users.
+
+Here is the briefest record of our progress (* means estimated):
+
+eBooks Year Month
+
+    1  1971 July
+   10  1991 January
+  100  1994 January
+ 1000  1997 August
+ 1500  1998 October
+ 2000  1999 December
+ 2500  2000 December
+ 3000  2001 November
+ 4000  2001 October/November
+ 6000  2002 December*
+ 9000  2003 November*
+10000  2004 January*
+
+
+The Project Gutenberg Literary Archive Foundation has been created
+to secure a future for Project Gutenberg into the next millennium.
+
+We need your donations more than ever!
+
+As of February, 2002, contributions are being solicited from people
+and organizations in: Alabama, Alaska, Arkansas, Connecticut,
+Delaware, District of Columbia, Florida, Georgia, Hawaii, Illinois,
+Indiana, Iowa, Kansas, Kentucky, Louisiana, Maine, Massachusetts,
+Michigan, Mississippi, Missouri, Montana, Nebraska, Nevada, New
+Hampshire, New Jersey, New Mexico, New York, North Carolina, Ohio,
+Oklahoma, Oregon, Pennsylvania, Rhode Island, South Carolina, South
+Dakota, Tennessee, Texas, Utah, Vermont, Virginia, Washington, West
+Virginia, Wisconsin, and Wyoming.
+
+We have filed in all 50 states now, but these are the only ones
+that have responded.
+
+As the requirements for other states are met, additions to this list
+will be made and fund raising will begin in the additional states.
+Please feel free to ask to check the status of your state.
+
+In answer to various questions we have received on this:
+
+We are constantly working on finishing the paperwork to legally
+request donations in all 50 states.  If your state is not listed and
+you would like to know if we have added it since the list you have,
+just ask.
+
+While we cannot solicit donations from people in states where we are
+not yet registered, we know of no prohibition against accepting
+donations from donors in these states who approach us with an offer to
+donate.
+
+International donations are accepted, but we don't know ANYTHING about
+how to make them tax-deductible, or even if they CAN be made
+deductible, and don't have the staff to handle it even if there are
+ways.
+
+Donations by check or money order may be sent to:
+
+ PROJECT GUTENBERG LITERARY ARCHIVE FOUNDATION
+ 809 North 1500 West
+ Salt Lake City, UT 84116
+
+Contact us if you want to arrange for a wire transfer or payment
+method other than by check or money order.
+
+The Project Gutenberg Literary Archive Foundation has been approved by
+the US Internal Revenue Service as a 501(c)(3) organization with EIN
+[Employee Identification Number] 64-622154.  Donations are
+tax-deductible to the maximum extent permitted by law.  As fund-raising
+requirements for other states are met, additions to this list will be
+made and fund-raising will begin in the additional states.
+
+We need your donations more than ever!
+
+You can get up to date donation information online at:
+
+http://www.gutenberg.net/donation.html
+
+
+***
+
+If you can't reach Project Gutenberg,
+you can always email directly to:
+
+Michael S. Hart <hart@pobox.com>
+
+Prof. Hart will answer or forward your message.
+
+We would prefer to send you information by email.
+
+
+**The Legal Small Print**
+
+
+(Three Pages)
+
+***START**THE SMALL PRINT!**FOR PUBLIC DOMAIN EBOOKS**START***
+Why is this "Small Print!" statement here? You know: lawyers.
+They tell us you might sue us if there is something wrong with
+your copy of this eBook, even if you got it for free from
+someone other than us, and even if what's wrong is not our
+fault. So, among other things, this "Small Print!" statement
+disclaims most of our liability to you. It also tells you how
+you may distribute copies of this eBook if you want to.
+
+*BEFORE!* YOU USE OR READ THIS EBOOK
+By using or reading any part of this PROJECT GUTENBERG-tm
+eBook, you indicate that you understand, agree to and accept
+this "Small Print!" statement. If you do not, you can receive
+a refund of the money (if any) you paid for this eBook by
+sending a request within 30 days of receiving it to the person
+you got it from. If you received this eBook on a physical
+medium (such as a disk), you must return it with your request.
+
+ABOUT PROJECT GUTENBERG-TM EBOOKS
+This PROJECT GUTENBERG-tm eBook, like most PROJECT GUTENBERG-tm eBooks,
+is a "public domain" work distributed by Professor Michael S. Hart
+through the Project Gutenberg Association (the "Project").
+Among other things, this means that no one owns a United States copyright
+on or for this work, so the Project (and you!) can copy and
+distribute it in the United States without permission and
+without paying copyright royalties. Special rules, set forth
+below, apply if you wish to copy and distribute this eBook
+under the "PROJECT GUTENBERG" trademark.
+
+Please do not use the "PROJECT GUTENBERG" trademark to market
+any commercial products without permission.
+
+To create these eBooks, the Project expends considerable
+efforts to identify, transcribe and proofread public domain
+works. Despite these efforts, the Project's eBooks and any
+medium they may be on may contain "Defects". Among other
+things, Defects may take the form of incomplete, inaccurate or
+corrupt data, transcription errors, a copyright or other
+intellectual property infringement, a defective or damaged
+disk or other eBook medium, a computer virus, or computer
+codes that damage or cannot be read by your equipment.
+
+LIMITED WARRANTY; DISCLAIMER OF DAMAGES
+But for the "Right of Replacement or Refund" described below,
+[1] Michael Hart and the Foundation (and any other party you may
+receive this eBook from as a PROJECT GUTENBERG-tm eBook) disclaims
+all liability to you for damages, costs and expenses, including
+legal fees, and [2] YOU HAVE NO REMEDIES FOR NEGLIGENCE OR
+UNDER STRICT LIABILITY, OR FOR BREACH OF WARRANTY OR CONTRACT,
+INCLUDING BUT NOT LIMITED TO INDIRECT, CONSEQUENTIAL, PUNITIVE
+OR INCIDENTAL DAMAGES, EVEN IF YOU GIVE NOTICE OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+If you discover a Defect in this eBook within 90 days of
+receiving it, you can receive a refund of the money (if any)
+you paid for it by sending an explanatory note within that
+time to the person you received it from. If you received it
+on a physical medium, you must return it with your note, and
+such person may choose to alternatively give you a replacement
+copy. If you received it electronically, such person may
+choose to alternatively give you a second opportunity to
+receive it electronically.
+
+THIS EBOOK IS OTHERWISE PROVIDED TO YOU "AS-IS". NO OTHER
+WARRANTIES OF ANY KIND, EXPRESS OR IMPLIED, ARE MADE TO YOU AS
+TO THE EBOOK OR ANY MEDIUM IT MAY BE ON, INCLUDING BUT NOT
+LIMITED TO WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A
+PARTICULAR PURPOSE.
+
+Some states do not allow disclaimers of implied warranties or
+the exclusion or limitation of consequential damages, so the
+above disclaimers and exclusions may not apply to you, and you
+may have other legal rights.
+
+INDEMNITY
+You will indemnify and hold Michael Hart, the Foundation,
+and its trustees and agents, and any volunteers associated
+with the production and distribution of Project Gutenberg-tm
+texts harmless, from all liability, cost and expense, including
+legal fees, that arise directly or indirectly from any of the
+following that you do or cause:  [1] distribution of this eBook,
+[2] alteration, modification, or addition to the eBook,
+or [3] any Defect.
+
+DISTRIBUTION UNDER "PROJECT GUTENBERG-tm"
+You may distribute copies of this eBook electronically, or by
+disk, book or any other medium if you either delete this
+"Small Print!" and all other references to Project Gutenberg,
+or:
+
+[1]  Only give exact copies of it.  Among other things, this
+     requires that you do not remove, alter or modify the
+     eBook or this "small print!" statement.  You may however,
+     if you wish, distribute this eBook in machine readable
+     binary, compressed, mark-up, or proprietary form,
+     including any form resulting from conversion by word
+     processing or hypertext software, but only so long as
+     *EITHER*:
+
+     [*]  The eBook, when displayed, is clearly readable, and
+          does *not* contain characters other than those
+          intended by the author of the work, although tilde
+          (~), asterisk (*) and underline (_) characters may
+          be used to convey punctuation intended by the
+          author, and additional characters may be used to
+          indicate hypertext links; OR
+
+     [*]  The eBook may be readily converted by the reader at
+          no expense into plain ASCII, EBCDIC or equivalent
+          form by the program that displays the eBook (as is
+          the case, for instance, with most word processors);
+          OR
+
+     [*]  You provide, or agree to also provide on request at
+          no additional cost, fee or expense, a copy of the
+          eBook in its original plain ASCII form (or in EBCDIC
+          or other equivalent proprietary form).
+
+[2]  Honor the eBook refund and replacement provisions of this
+     "Small Print!" statement.
+
+[3]  Pay a trademark license fee to the Foundation of 20% of the
+     gross profits you derive calculated using the method you
+     already use to calculate your applicable taxes.  If you
+     don't derive profits, no royalty is due.  Royalties are
+     payable to "Project Gutenberg Literary Archive Foundation"
+     the 60 days following each date you prepare (or were
+     legally required to prepare) your annual (or equivalent
+     periodic) tax return.  Please contact us beforehand to
+     let us know your plans and to work out the details.
+
+WHAT IF YOU *WANT* TO SEND MONEY EVEN IF YOU DON'T HAVE TO?
+Project Gutenberg is dedicated to increasing the number of
+public domain and licensed works that can be freely distributed
+in machine readable form.
+
+The Project gratefully accepts contributions of money, time,
+public domain materials, or royalty free copyright licenses.
+Money should be paid to the:
+"Project Gutenberg Literary Archive Foundation."
+
+If you are interested in contributing scanning equipment or
+software or other items, please contact Michael Hart at:
+hart@pobox.com
+
+[Portions of this eBook's header and trailer may be reprinted only
+when distributed free of all fees.  Copyright (C) 2001, 2002 by
+Michael S. Hart.  Project Gutenberg is a TradeMark and may not be
+used in any sales of Project Gutenberg eBooks or other materials be
+they hardware or software or any other related product without
+express permission.]
+
+*END THE SMALL PRINT! FOR PUBLIC DOMAIN EBOOKS*Ver.02/11/02*END*
+

resources/TOY/add.toy

@@ -0,0 +1,14 @@
+program Add
+// Input:    Stored in memory location 00 and 01  
+// Output:   Sum of two integers 5 + 8 = D saved in memory location 02.
+// Remarks:  
+// -----------------------------------------------------------------------------
+00: 0008   (0000 0000 0000 1000,      8) 
+01: 0005   (0000 0000 0000 0101,      5)  
+02: 0000   (0000 0000 0000 0000,      0) 
+
+10: 8A00   R[A] <- mem[00]               
+11: 8B01   R[B] <- mem[01]               
+12: 1CAB   R[C] <- R[A] + R[B]           
+13: 9C02   mem[02] <- R[C]               
+14: 0000   halt                          

resources/TOY/cheatsheet.txt

@@ -0,0 +1,37 @@
+
+             TOY REFERENCE CARD
+
+
+INSTRUCTION FORMATS
+             
+             | . . . . | . . . . | . . . . | . . . .|
+  Format 1:  | opcode  |    d    |    s    |    t   |  (0-6, A-B)
+  Format 2:  | opcode  |    d    |       addr       |  (7-9, C-F)
+
+
+ARITHMETIC and LOGICAL operations
+    1: add              R[d] <- R[s] +  R[t]
+    2: subtract         R[d] <- R[s] -  R[t]
+    3: and              R[d] <- R[s] &  R[t]
+    4: xor              R[d] <- R[s] ^  R[t]
+    5: shift left       R[d] <- R[s] << R[t]
+    6: shift right      R[d] <- R[s] >> R[t]
+
+TRANSFER between registers and memory
+    7: load address     R[d] <- addr
+    8: load             R[d] <- mem[addr]
+    9: store            mem[addr] <- R[d]
+    A: load indirect    R[d] <- mem[R[t]]
+    B: store indirect   mem[R[t]] <- R[d]
+
+CONTROL
+    0: halt             halt
+    C: branch zero      if (R[d] == 0) pc <- addr
+    D: branch positive  if (R[d] >  0) pc <- addr
+    E: jump register    pc <- R[d]
+    F: jump and link    R[d] <- pc; pc <- addr
+
+
+Register 0 always reads 0.
+Loads from mem[FF] come from stdin.
+Stores to mem[FF] go to stdout.

resources/TOY/chop.toy

@@ -0,0 +1,25 @@
+program Chop
+// Input:    N
+// Output:   The unique set of powers of 2 which sum to N
+// Remarks:  This program uses the fact that numbers in the toy machine are
+//           represented by 16-bit signed two's complement numbers.  To learn
+//           more about signed two's complement numbers, please see Professor
+//           Wayne's notes on the TOY machine.  Note: a non-positive value of N
+//           will cause undefined behavior.
+// -----------------------------------------------------------------------------
+
+// Initialize
+10: 82FF   read R[2]                     
+
+// Check for non-positive values
+11: D213   if (R[2] > 0) goto 13         
+12: 0000   halt                          
+
+// Loop
+13: 2302   R[3] <- -R[2]                 
+14: 3423   R[4] <- R[2] & R[3]           
+15: 94FF   write R[4]                    
+16: 2224   R[2] <- R[2] - R[4]           
+17: D211   if (R[2] > 0) goto 11         
+
+18: 0000   halt                          

resources/TOY/crazy8.toy

@@ -0,0 +1,30 @@
+program Crazy 8
+// Input:    A list of up to 16 positive integers terminated by a 0000
+// Output:   The positive integers in reverse order
+// Remarks:  The data is stored starting at memory location 00.
+//           If you enter more than 16 integers, you will overwrite
+//           the program itself. To see the crazy 8 virus, enter 
+//           1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1     (16 1's) 
+//           8888 8810 98FF C011
+// -----------------------------------------------------------------------------
+10: 7101   R[1] <- 0001                  R[1] always 1
+11: 7A00   R[A] <- 0000                  memory address of array a[]
+12: 7B00   R[B] <- 0000                  # elements in array = n
+
+// Read in sequence of positive integers
+13: 8CFF   read R[C]                     while (1) {
+14: CC19   if (R[C] == 0) goto 19           if ((read R[C]) == 0) break
+15: 16AB   R[6] <- R[A] + R[B]              a + n
+16: BC06   mem[R[6]] <- R[C]                a[n] = c
+17: 1BB1   R[B] <- R[B] + R[1]              n++
+18: C013   goto 13                       }
+
+// Print out results in reverse order
+19: CB20   if (R[B] == 0) goto 20        while (n != 0) {
+1A: 16AB   R[6] <- R[A] + R[B]              a + n
+1B: 2661   R[6] <- R[6] - R[1]              a + n - 1
+1C: AC06   R[C] <- mem[R[6]]                c = a[n-1]
+1D: 9CFF   write R[C]                       print c
+1E: 2BB1   R[B] <- R[B] - R[1]              n--
+1F: C019   goto 19                       }
+20: 0000   halt                          

resources/TOY/fibonacci.toy

@@ -0,0 +1,16 @@
+program Fibonacci (print to stdout)
+// Input:    None
+// Output:   Prints positive fibonacci numbers to standard output.
+// -----------------------------------------------------------------------------
+
+00: 0000   0
+01: 0001   1
+
+10: 8A00   RA <- mem[00]            a = 0
+11: 8B01   RB <- mem[01]            b = 1
+                                    while(a > 0) {
+12: 9AFF   print RA                    System.out.println(a)
+13: 1AAB   RA <- RA + RB               a = a + b
+14: 2BAB   RB <- RA - RB               b = a - b
+15: DA12   if (RA > 0) goto 12      }
+16: 0000   halt  

resources/TOY/gcd.toy

@@ -0,0 +1,30 @@
+program Greatest Common Divisor
+// Input:    a, b
+// Output:   gcd(a, b)
+// Remarks:  Uses Euclid's inefficient subtraction algorithm does not handle
+//           negative integers
+// -----------------------------------------------------------------------------
+10: 8AFF   read R[A]                     a
+11: 8BFF   read R[B]                     b
+12: FF30   R[F] <- pc; goto 30           
+13: 9CFF   write R[C]                    gcd(a, b)
+14: 0000   halt                          
+
+function gcd
+// Input:                R[A] and R[B] (should be passed by value)
+// Return address:       R[F]
+// Output:               R[C] = gcd(R[A], R[B])
+// Temporary variables:  R[D]
+
+30: CB38   if (R[B] == 0) goto 38        while (b != 0) {
+31: 2DAB   R[D] <- R[A] - R[B]              if (b >= a) {
+32: DD36   if (R[D] > 0) goto 36               // swap and b
+33: 1DA0   R[D] <- R[A]                        temp = a;
+34: 1AB0   R[A] <- R[B]                        a = b;
+35: 1BD0   R[B] <- R[D]                        b = temp;
+//                                          }
+36: 2AAB   R[A] <- R[A] - R[B]              a -= b;
+37: C030   goto 30                       }
+
+38: 1CA0   R[C] <- R[A]                  c = a;
+39: EF00   goto R[F]                     return c;

resources/TOY/graycode.toy

@@ -0,0 +1,18 @@
+program Gray Code
+// Input:    Integer n (0 - E) from standard input.
+// Output:   Gray code of order n to standard output.
+// -----------------------------------------------------------------------------
+
+// Initialize
+10: 8AFF   read RA                       n = StdIn.readInt()
+11: 7101   R1 <- 1                       always 1
+12: 5B1A   RB <- 1 << RA                 i = 2^n
+
+                                         while (i != 0) {
+13: 2BB1   RB <- RB - 1                     i = 2^n - 1
+14: 6CB1   RC <- RB >> R1                   c = (i >> 1)
+15: 4DBC   RD <- RB ^ RC                    d = i ^ (i >> 1)
+16: 9DFF   write RD                         print RD
+17: DB13   if (RB > 0) pc <- 13          }
+
+18: 0000   halt

resources/TOY/horner.toy

@@ -0,0 +1,40 @@
+program Horner's method
+// Input:    x, n, a_n, . . ., a_2, a_1, a_0
+// Output:   p_n(x) = a_n x^n + . . .  + a_2 x^2 + a_1 x + a_0
+// Remarks:  polynomial evaluation via Horner's method
+//           Idea:  p_3(x) = ((a_3 * x + a_2) * x + a_1) * x + a_0
+//           Example 1 : to convert 765 decimal to hex, enter input
+//                       A 2 7 6 5
+//           Example 2:  to convert 100 1111 0011 from binary to hex, enter
+//                       2 A 1 0 0 1 1 1 1 0 0 1 1
+// -----------------------------------------------------------------------------
+10: 7C00   R[C] <- 0000                  result c
+11: 7101   R[1] <- 0001                  always 1
+12: 82FF   read R[2]                     read x
+13: 83FF   read R[3]                     read n
+
+14: 84FF   read R[4]                     do { read a_i
+15: 1A20   R[A] <- R[2]                  |
+16: 1BC0   R[B] <- R[C]                  |    c *= x
+17: FF30   R[F] <- pc; goto 30           |  
+18: 1CC4   R[C] <- R[C] + R[4]                c += a_i
+19: C31C   if (R[3] == 0) goto 1C        |
+1A: 2331   R[3] <- R[3] - R[1]           | } while (i-- >= 0)
+1B: C014   goto 14                       |
+
+1C: 9CFF   write R[C]                    
+1D: 0000   halt                          
+
+function multiply
+// Input:                R[A] and R[B] (should be passed by value)
+// Return address:       R[F]
+// Output:               R[C] = R[A] * R[B]
+// Temporary variables:  R[1] = 1
+
+30: 7C00   R[C] <- 0000                  
+31: 7101   R[1] <- 0001                  
+32: CA36   if (R[A] == 0) goto 36        
+33: 1CCB   R[C] <- R[C] + R[B]           
+34: 2AA1   R[A] <- R[A] - R[1]           
+35: C032   goto 32                       
+36: EF00   goto R[F]                     

resources/TOY/infinite_loop.toy

@@ -0,0 +1,9 @@
+program Infinite Loop
+// Input:    -
+// Output:   -
+// Remarks:  This program contains an infinite loop.
+// -----------------------------------------------------------------------------
+
+10: 1000   no-op                         
+11: 1000   no-op                         
+12: C010   goto 10                       

resources/TOY/multiply-fast.toy

@@ -0,0 +1,30 @@
+program Fast Multiply 
+// Input:    integers a and b stored in mem[0A], mem[0B]
+// Output:   integer c = a * b stored in mem[0C]
+// Remarks:  Binary Multiplication
+// -----------------------------------------------------------------------------
+
+0A: 0003   (0000 0000 0000 0011,  3)      input  a
+0B: 0009   (0000 0000 0000 1001,  9)      input  b
+0C: 0000   (0000 0000 0000 0000,  0)      output c
+
+0D: 0000   (0000 0000 0000 0000,  0)      constant 0
+0E: 0001   (0000 0000 0000 0000,  1)      constant 1
+0F: 0010   (0000 0000 0001 0000, 16)      constant 16
+
+10: 8A0A   R[A] <- mem[0A]               
+11: 8B0B   R[B] <- mem[0B]               
+12: 8C0D   R[C] <- mem[0D]               result
+13: 810E   R[1] <- mem[0E]               always 1
+14: 820F   R[2] <- mem[0F]               i = 16
+
+                                         do {
+15: 2221   R[2] <- R[2] - R[1]              i--
+16: 53A2   R[3] <- R[A] << R[2]             a << i
+17: 64B2   R[4] <- R[B] >> R[2]             b >> i
+18: 3441   R[4] <- R[4] & R[1]              bi = ith bit of b
+19: C41B   if (R[4] == 0) goto 1B           if bi is 1 
+1A: 1CC3   R[C] <- R[C] + R[3]                 add a << i to sum
+1B: D215   if (R[2] > 0) goto 15         }
+
+1C: 9C0C   mem[0C] <- R[C]               

resources/TOY/multiply-function.toy

@@ -0,0 +1,35 @@
+program Multiply-function
+// Input:    x, y, and z
+// Output:   x * y * z
+// Remarks:  Inefficient for large or negative values of x or y
+// -----------------------------------------------------------------------------
+10: 82FF   read R[2]                     x
+11: 83FF   read R[3]                     y
+12: 84FF   read R[4]                     z
+
+// Multiply x and y
+13: 1A20   R[A] <- R[2]                  x
+14: 1B30   R[B] <- R[3]                  y
+15: FF30   R[F] <- pc; goto 30           x * y
+
+// Multiply (x * y) and z
+16: 1AC0   R[A] <- R[C]                  x * y
+17: 1B40   R[B] <- R[4]                  z
+18: FF30   R[F] <- pc; goto 30           (x * y) * z
+
+19: 9CFF   write R[C]                    
+1A: 0000   halt                          
+
+function multiply
+// Input:                R[A] and R[B] (should be passed by value)
+// Return address:       R[F]
+// Output:               R[C] = R[A] * R[B]
+// Temporary variables:  R[1] = 1
+
+30: 7C00   R[C] <- 0000                  
+31: 7101   R[1] <- 0001                  
+32: CA36   if (R[A] == 0) goto 36        
+33: 1CCB   R[C] <- R[C] + R[B]           
+34: 2AA1   R[A] <- R[A] - R[1]           
+35: C032   goto 32                       
+36: EF00   goto R[F]                     

resources/TOY/multiply.toy

@@ -0,0 +1,27 @@
+program Multiply
+// Input:    integers a and b stored in mem[0A], mem[0B]
+// Output:   integer c = a * b stored in mem[0C]
+// Remarks:  Inefficient
+// -----------------------------------------------------------------------------
+
+0A: 0003   (0000 0000 0000 0111,      3) 
+0B: 0009   (0000 0000 0000 1001,      9) 
+0C: 0000   (0000 0000 0000 0000,      0) 
+
+0D: 0000   (0000 0000 0000 0000,      0) 
+0E: 0001   (0000 0000 0000 0001,      1) 
+
+
+10: 8A0A   RA <- mem[0A] 		a
+11: 8B0B   RB <- mem[0B] 		b
+12: 8C0D   RC <- mem[0D]		c = 0;
+
+13: 810E   R1 <- mem[0E]		always 1
+
+14: CA18   if (RA == 0) pc goto 18	while (a != 0) {
+15: 1CCB   RC <- RC + RB		   c = c + b;
+16: 2AA1   RA <- RA - R1		   a = a - 1;
+17: C014   pc <- 14			}
+
+18: 9C0C   mem[0C] <- RC
+19: 0000   halt

resources/TOY/powers2.toy

@@ -0,0 +1,13 @@
+program Powers of 2
+// Input:    None
+// Output:   Prints out the positive powers of 2
+// -----------------------------------------------------------------------------
+
+00: 0001   1
+
+10: 8A00   RA <- mem[00]                1
+                                        while (a != 0) {
+11: 9AFF   write RA                        System.out.println(a)
+12: 1AAA   RA <- RA + RA                   a = a + a
+13: DA11   if (RA > 0) goto 11         }
+14: 0000   halt

resources/TOY/reverse.toy

@@ -0,0 +1,26 @@
+program Reverse
+// Input:    A list of positive integers terminated by a 0000
+// Output:   The positive integers in reverse order.
+// Remarks:  The data is stored starting at memory location 30.
+// -----------------------------------------------------------------------------
+10: 7101   R[1] <- 0001                  R[1] always 1
+11: 7A30   R[A] <- 0030                  memory address of array a[]
+12: 7B00   R[B] <- 0000                  # elements in array = n
+
+// read in sequence of positive integers
+13: 8CFF   read R[C]                     while (read R[C]) {
+14: CC19   if (R[C] == 0) goto 19           if (c == 0) break
+15: 16AB   R[6] <- R[A] + R[B]              a + n
+16: BC06   mem[R[6]] <- R[C]                a[n] = c
+17: 1BB1   R[B] <- R[B] + R[1]              n++
+18: C013   goto 13                       }
+
+// print out results in reverse order
+19: CB20   if (R[B] == 0) goto 20        while (n != 0) {
+1A: 16AB   R[6] <- R[A] + R[B]              a + n
+1B: 2661   R[6] <- R[6] - R[1]              a + n - 1
+1C: AC06   R[C] <- mem[R[6]]                c = a[n-1]
+1D: 9CFF   write R[C]                       print c
+1E: 2BB1   R[B] <- R[B] - R[1]              n--
+1F: C019   goto 19                       }
+20: 0000   halt  

resources/TOY/stdin.toy

@@ -0,0 +1,11 @@
+program Stdin
+// Input:    Two integers from standard input
+// Output:   Sum of the two integers
+// Remarks:  
+// -----------------------------------------------------------------------------
+
+10: 8AFF    read R[A] from stdin
+11: 8BFF    read R[B] from stdin
+12: 1CAB    R[C] <- R[A] + R[B]
+13: 9CFF    write R[C] to stdout
+14: 0000    halt

resources/TOY/subtract.toy

@@ -0,0 +1,14 @@
+program Subtract
+// Input:    Stored in memory location 00 and 01  
+// Output:   Difference of two integers 5 - 8 = FFFD saved in memory location 02.
+// Remarks:  
+// -----------------------------------------------------------------------------
+00: 0005   (0000 0000 0000 0101,      5)  
+01: 0008   (0000 0000 0000 1000,      8) 
+02: 0000   (0000 0000 0000 0000,      0) 
+
+10: 8A00   R[A] <- mem[00]               
+11: 8B01   R[B] <- mem[01]               
+12: 2CAB   R[C] <- R[A] - R[B]           
+13: 9C02   mem[02] <- R[C]               
+14: 0000   halt                          

resources/TOY/sum.toy

@@ -0,0 +1,14 @@
+program Sum
+// Input:    Sequence of non-zero integers, followed by 0000
+// Output:   The sum of all the integers.
+// -----------------------------------------------------------------------------
+
+// Initialize
+10: 7C00   RC <- 0000                    sum = 0
+                                         while (true) {
+11: 8AFF   read RA                          read a
+12: CA15   if (RA == 0) pc <- 15            if (a == 0) break 
+13: 1CCA   RC <- RC + RA                    sum = sum + a
+14: C011   pc <- 11                      }
+15: 9CFF   write RC                      write sum
+16: 0000   halt

resources/TOY/sum_1-n.toy

@@ -0,0 +1,20 @@
+program Sum 1-N
+// Input:    N
+// Output:   The sum of all integers between 1 and N inclusive
+// Remarks:  Please note that the highest value of N that can be processed
+//           without overflow is 00FF.
+// -----------------------------------------------------------------------------
+
+// Initialize
+10: 7101   R[1] <- 0001                  
+11: 82FF   read R[2]                     
+12: 7300   R[3] <- 0000                  
+
+// Add, decrement, and loop
+13: 1332   R[3] <- R[3] + R[2]           
+14: 2221   R[2] <- R[2] - R[1]           
+15: D213   if (R[2] > 0) goto 13         
+
+// Print the sum
+16: 93FF   write R[3]                    
+17: 0000   halt                          

resources/Turing.txt

@@ -0,0 +1,8 @@
+Turing, Alan 
+10.24 
+5 
+100 ADBE 
+ 25 GOOG 
+ 97 IBM 
+250 MSFT 
+200 YHOO 

resources/amino.csv

@@ -0,0 +1,64 @@
+TTT,Phe,F,Phenylalanine
+TTC,Phe,F,Phenylalanine
+TTA,Leu,L,Leucine
+TTG,Leu,L,Leucine
+TCT,Ser,S,Serine
+TCC,Ser,S,Serine
+TCA,Ser,S,Serine
+TCG,Ser,S,Serine
+TAT,Tyr,Y,Tyrosine
+TAC,Tyr,Y,Tyrosine
+TAA,Stop,Stop,Stop
+TAG,Stop,Stop,Stop
+TGT,Cys,C,Cysteine
+TGC,Cys,C,Cysteine
+TGA,Stop,Stop,Stop
+TGG,Trp,W,Tryptophan
+CTT,Leu,L,Leucine
+CTC,Leu,L,Leucine
+CTA,Leu,L,Leucine
+CTG,Leu,L,Leucine
+CCT,Pro,P,Proline
+CCC,Pro,P,Proline
+CCA,Pro,P,Proline
+CCG,Pro,P,Proline
+CAT,His,H,Histidine
+CAC,His,H,Histidine
+CAA,Gln,Q,Glutamine
+CAG,Gln,Q,Glutamine
+CGT,Arg,R,Arginine
+CGC,Arg,R,Arginine
+CGA,Arg,R,Arginine
+CGG,Arg,R,Arginine
+ATT,Ile,I,Isoleucine
+ATC,Ile,I,Isoleucine
+ATA,Ile,I,Isoleucine
+ATG,Met,M,Methionine
+ACT,Thr,T,Threonine
+ACC,Thr,T,Threonine
+ACA,Thr,T,Threonine
+ACG,Thr,T,Threonine
+AAT,Ala,A,Alanine
+AAC,Ala,A,Alanine
+AAA,Lys,K,Lysine
+AAG,Lys,K,Lysine
+AGT,Ser,S,Serine
+AGC,Ser,S,Serine
+AGA,Arg,R,Arginine
+AGG,Arg,R,Arginine
+GTT,Val,V,Valine
+GTC,Val,V,Valine
+GTA,Val,V,Valine
+GTG,Val,V,Valine
+GCT,Ala,A,Alanine
+GCC,Ala,A,Alanine
+GCA,Ala,A,Alanine
+GCG,Ala,A,Alanine
+GAT,Asp,D,Aspartic Acid
+GAC,Asp,D,Aspartic Acid
+GAA,Gly,G,Glutamic Acid
+GAG,Gly,G,Glutamic Acid
+GGT,Gly,G,Glycine
+GGC,Gly,G,Glycine
+GGA,Gly,G,Glycine
+GGG,Gly,G,Glycine

resources/audio/99luftballons.txt

@@ -0,0 +1,46 @@
+2 .50 .25-2 .752 .50 .5-2 .25-5 .75
+
+-100 .5
+3 .253 .253 .53 .53 .53 .252 .25
+-100 .250 .25
+-100 .25-2 .750 .52 .25-2 .752 .50 .5-2 .25-5 .75
+
+-100 .5
+
+-2 .25-2 .25-100 .25-2 .75-5 .50 .250 .25-100 .250 1.5
+
+-100 .25
+
+-2 .1-100 .1-2 .1-5 .2-2 .2-5 .2-100 1-2 .1-100 .1-2 .1-5 .2-2 .2-5 .15-14 1.1
+
+-100 .2
+-2  .1-100 .1-2 .1-5 .2-2 .2 -5 .2-100 1.1-2 .1-100 .1-2 .1-5 .2-2 .2-5 .15-14 1.1-100 .5
+
+-2 .1-100 .075-2 .1-5 .2-2 .2-5 .2
+0 .12 .10 .1-2 .1-100 .1-2 .1-5 .1-2 .1-100 .075-2 .1-5 .2-2 .2-5 .2-7 .1-7 .1-100 .075-7 .1-100 .075-7 .1-5 .1-2 .1
+
+-100 .1
+
+-2 .1-5 .2-2 .2-5 .2
+
+0 .12 .10 .1-2 .1-100 .1-2 .1-5 .1-2 .1-100 .075-2 .1-5 .2-2 .2-5 .2
+
+-7 .1
+-7 .1
+-7 .1
+-7 .1
+-7 .1
+-7 .1
+-7 .1
+-7 .1
+
+0 .252 .15-2 .42 .250 .25-2 .15-5 .25-100 .4
+
+3 .153 .15 -100 .13 .43 .253 .152 .15-100 .090 .35-2 .250 .252 .15-2 .4 2 .250 .25-2 .15-5 .4-100 .4
+
+3 .33 .33 .33 .33 .152 .15-100 .10 .4-2 .250 .252 .15-2 .42 .250 .25-2 .15-5 .4-100 .4
+
+-2 .3-5 .15-2 .453 .33 .152 .15-100 .1-2 .450 .30 .32 .15-2 .452 .30 .3-2 .15-5 .45-100 .4
+
+3 .273 .123 .12-100 .083 .12-100 .083 .12-100 .083 .122 .122 .12-100 .08
+2 .120 .12-2 .15

resources/audio/Ascale.txt

@@ -0,0 +1,18 @@
+0  .5
+2  .5
+4  .5
+5  .5
+7  .5
+9  .5
+11 .5
+12 .5
+
+12 .5
+11 .5
+9  .5
+7  .5
+5  .5
+4  .5
+2  .5
+0  .5
+

resources/audio/National_Anthem.txt

@@ -0,0 +1,106 @@
+-9 .2
+-4 .2
+-2 .2
+0  .45
+0  .45
+0  .2
+-2 .2
+-4 .2
+-5 .2
+-4 .45
+-4 .45
+-4 .2
+-5 .2
+-7 .2
+-9 .2
+-7 .45
+-9 .45
+
+-100 .2
+
+-4 .2
+-2 .2
+-4 .2
+-5 1.0
+
+-100 .2
+
+-9 .2
+-5 .2
+-4 .2
+-2 .45
+-5 .45
+-4 .45
+-2 .45
+0  .3
+5  .1
+3  .6
+
+-100 .9
+
+0  .3
+0  .1
+-9 0.8
+-9 .2
+-5 .2
+-2 .2
+-4 1.0
+
+-100 .45
+
+-4 .3
+-4 .1
+1  .45
+5  .45
+5  .45
+3  .3
+2  .1
+3  1.0
+
+-100 .6
+
+-9 .2
+-5 .2
+-4 .2
+-2 .45
+-5 .45
+-4 .45
+-2 .45
+0  1.0
+
+-100 .6
+
+-4 .3
+-4 .1
+1  .45
+5  .45
+5  .45
+3  .3
+2  .1
+3  1.0
+
+-100 .6
+
+0  .3
+-2 .1
+-4 .6
+
+-100 .2
+
+-4 .2
+0  .2
+1  .2
+3  1.0
+
+-100 .6
+
+3  .3
+5  .1
+3  .6
+
+-100 .2
+
+1  .2
+0  .2
+-2 .2
+-4 1.5

resources/audio/StairwayToHeaven.txt

@@ -0,0 +1,127 @@
+0 .25
+3 .25
+7 .25
+12 .25
+14 .25
+7 .25
+3 .25
+14 .25
+15 .25
+7 .25
+3 .25
+15 .25
+9 .125
+5 .125
+0 .125
+9 .25
+7 .25
+3 .25
+0 .25
+3 .25
+7 .125
+3 .125
+0 .125
+-2 .25
+0 .25
+0 .5
+
+-1000 .5
+
+-12 .25
+-10 .25
+-9 .25
+-5 .25
+-2 .25
+7 .25
+9 .25
+5 .25
+0 .25
+9 .25
+7 .25
+3 .25
+0 .25
+7 .25
+2 .125
+3 .125
+0 .5
+
+-1000 .5
+
+-12 .25
+-10 .25
+-9 .25
+-2 .25
+-5 .25
+3 .25
+10 .25
+2 .25
+-2 .25
+10 .25
+10 .25
+9 .25
+9 .5
+
+-1000 1
+
+0 .25
+3 .25
+7 .25
+12 .25
+14 .25
+7 .25
+3 .25
+14 .25
+15 .25
+7 .25
+3 .25
+15 .25
+9 .125
+5 .125
+0 .125
+9 .25
+7 .25
+3 .25
+0 .25
+3 .25
+7 .125
+3 .125
+0 .125
+-2 .25
+0 .25
+0 .5
+
+-1000 .5
+
+-12 .25
+-10 .25
+-9 .25
+-5 .25
+-2 .25
+7 .25
+9 .25
+5 .25
+0 .25
+9 .25
+7 .25
+3 .25
+0 .25
+7 .25
+2 .125
+3 .125
+0 .5
+
+-1000 .5
+
+-12 .25
+-10 .25
+-9 .25
+-2 .25
+-5 .25
+3 .25
+10 .25
+2 .25
+-2 .25
+10 .25
+10 .25
+9 .25
+9 .5

resources/audio/arabesque.txt

@@ -0,0 +1,71 @@
+-8	0.0833
+-5	0.0833
+0	0.0833
+4	0.0833
+7	0.0833
+9	0.0833
+
+11	0.0833
+6	0.0833
+2	0.0833
+-1	0.0833
+-6	0.0833
+-10	0.0833
+
+-12	0.0833
+-8	0.0833
+-3	0.0833
+0	0.0833
+4	0.0833
+6	0.0833
+
+7	0.0833
+2	0.0833
+-1	0.0833
+-5	0.0833
+-10	0.0833
+-13	0.0833
+
+-15	0.0833
+-12	0.0833
+-8	0.0833
+4	0.0833
+-3	0.0833
+0	0.0833
+
+9	0.0833
+-12	0.0833
+-8	0.0833
+4	0.0833
+-3	0.0833
+0	0.0833
+
+-6	0.0833
+-12	0.0833
+-8	0.0833
+4	0.0833
+-3	0.0833
+0	0.0833
+
+9	0.0833
+-12	0.0833
+-5	0.0833
+12	0.0833
+0	0.0833
+4	0.0833
+
+-22	0.0833
+-15	0.0833
+-12	0.0833
+12	0.1000
+-6	0.1200
+-3	0.1500
+
+0	0.1800
+4	0.2100
+6	0.2500
+4	0.3000
+11	0.4500
+9	0.6000
+
+7	1.0000

resources/audio/elise.txt

@@ -0,0 +1,106 @@
+7 .125 
+6 .125 
+7 .125 
+6 .125 
+7 .125 
+2 .125 
+5 .125 
+3 .125 
+0 .25  
+
+-100 .125
+
+ -9 .125
+ -5 .125
+  0 .125
+  2 .25
+
+-100 .125
+
+-5  .125
+-1  .125
+ 2  .125
+ 3  .25
+
+-100 .125
+
+-5 .125
+7 .125 
+6 .125 
+7 .125 
+6 .125 
+7 .125 
+2 .125 
+5 .125 
+3 .125 
+0 .25  
+
+-100 .125
+
+ -9 .125
+ -5 .125
+  0 .125
+  2 .25
+
+-100 .125 
+
+ -5 .125
+ -9 .125
+  2 .125
+  0 .5
+
+
+
+
+
+
+7 .125 
+6 .125 
+7 .125 
+6 .125 
+7 .125 
+2 .125 
+5 .125 
+3 .125 
+0 .25  
+
+-100 .125
+
+ -9 .125
+ -5 .125
+  0 .125
+  2 .25
+
+-100 .125
+
+-5  .125
+-1  .125
+ 2  .125
+ 3  .25
+
+-100 .125
+
+-5 .125
+7 .125 
+6 .125 
+7 .125 
+6 .125 
+7 .125 
+2 .125 
+5 .125 
+3 .125 
+0 .25  
+
+-100 .125
+
+ -9 .125
+ -5 .125
+  0 .125
+  2 .25
+
+-100 .125 
+
+ -5 .125
+ -9 .125
+  2 .125
+  0 .25

resources/audio/entertainer.txt

@@ -0,0 +1,86 @@
+2 .125
+3 .125
+4 .125
+12 .25
+4 .125
+12 .25
+4 .125
+12 .75
+
+12 .125
+14 .125
+15 .125
+16 .125
+12 .125
+14 .125
+16 .25
+11 .125
+14 .25
+12 .75
+
+2 .125
+3 .125
+4 .125
+12 .25
+4 .125
+12 .25
+4 .125
+12 .75
+
+9 .125
+7 .125
+6 .125
+9 .125
+12 .125
+16 .25
+14 .125
+12 .125
+9 .125
+14 .75
+    
+2 .125
+3 .125
+4 .125
+12 .25
+4 .125
+12 .25
+4 .125
+12 .75
+
+12 .125
+14 .125
+15 .125
+16 .125
+12 .125
+14 .125
+16 .25
+11 .125
+14 .25
+12 .75
+
+12 .125
+14 .125
+15 .125
+16 .125
+12 .125
+14 .125
+16 .25
+12 .125
+14 .125
+12 .125
+16 .125
+12 .125
+14 .125
+16 .25
+12 .125
+14 .125
+12 .125
+16 .125
+12 .125
+14 .125
+16 .25
+11 .125
+14 .25
+12 .25
+7 .25
+0 .25

resources/audio/firstcut.txt

@@ -0,0 +1,53 @@
+-12 .250
+-7  .250
+-5  .250
+-3  .250
+-2  .250
+-3  .250
+-5  .500
+-3  .250
+-5  .250
+-7 1.250
+
+-100 .500
+
+-3  .250
+0   .250
+2   .250
+0   .250
+
+-100 .250
+
+-2  .250
+-2  .250
+-3  .250
+-2  .250
+-5  .500
+-3  .250
+
+-100 1.00
+
+-7  .250
+-5  .250
+-3  .250
+-2  .250
+-3  .250
+-5  .500
+-3  .250
+-5  .250
+-7  .250
+-10 .500
+
+-100 .625
+
+-12  .125
+-3   .125
+-5   .125
+-7   .125
+-5   .750
+-3   .750
+-5   .125
+-7   .125
+-5   .125
+-7   .250
+

resources/audio/freebird.txt

@@ -0,0 +1,94 @@
+5  .065
+6  .015
+7  .015
+8  .015
+9  .015
+
+10 .625
+9  .125
+10 .500
+9  .625
+10 .125
+
+10 .125
+9  .125
+7  .125
+5  .125
+7  .125
+9  .125
+
+-100  .125
+
+5  .125
+7  .500
+7  .125
+5  .125
+2  .125
+2  .125
+
+3  .250
+8  .125
+8  .125
+8  .125
+7  .125
+3  .125
+-2 .375
+-2 .125
+2  .125
+3  .250
+5  .125
+
+5  .125
+4  .125
+5  .250
+5  .500
+
+17 .125
+15 .125
+12 .125
+16 .125
+17 .250
+17 .250
+
+9  .250
+10 .375
+9  .125
+10 .250
+9  .500
+9  .250
+10 .125
+10 .125
+
+
+10 .125
+9  .125
+7  .125
+5  .125
+7  .125
+9  .125
+
+-100  .125
+
+5  .125
+7  .5
+7  .125
+5  .125
+2  .125
+2  .125
+
+3  .25
+8  .125
+8  .125
+8  .125
+7  .125
+3  .125
+-2 .375
+-2 .125
+2  .125
+3  .25
+5  .125
+
+5  .125
+4  .125
+5  .25
+5  1

resources/audio/looney.txt

@@ -0,0 +1,73 @@
+7 .270 
+5 .090 
+3 .180 
+5 .180 
+7 .180 
+6 .180 
+7 .180
+3 .180
+5 .180
+5 .180
+5 .180
+5 .900
+
+5 .325 
+3 .125 
+2 .180 
+3 .180 
+5 .180 
+4 .180 
+5 .180 
+2 .180
+3 .180
+3 .180
+3 .180
+3 .900
+
+-2 .270
+-1 .090
+0 .270
+-1 .090
+-2 .180
+-1 .090
+0 .270
+-1 .090
+-2 .180
+5 .180
+5 .180
+5 .900
+    
+-2 .270
+-1 .090
+0 .270
+-1 .090
+-2 .180
+-1 .090
+0 .270
+-1 .090
+-2 .180
+7 .180
+7 .180
+7 .900
+
+7 .270 
+5 .090 
+3 .180 
+5 .180 
+7 .180 
+6 .180 
+7 .180
+3 .180
+5 .180
+5 .180
+5 .180
+5 .900
+
+0 .180
+-1 .180
+0 .180
+5 .540
+7 .360
+10 .720
+
+-100 5

resources/audio/old-nassau.txt

@@ -0,0 +1,58 @@
+3 4
+8 1.5
+7 .5
+8 .75
+9 .25
+10 .75
+12 .25
+10 1
+15 1
+15 1.5
+12 .5
+10 .75
+13 .25
+12 2
+3 1
+8 1.5
+7 .5
+8 .75
+9 .25
+10 .75
+12 .25
+13 1
+10 1
+8 1.5
+7 .5
+10 1.5
+11 .5
+12 3
+12 .75
+13 .25
+15 .75
+15 .25
+17 .75
+17 .25
+15 .75
+12 .25
+8 .75
+12 .25
+10 .75
+15 .25
+15 .75
+15 .25
+15 2.5
+12 .75
+13 .25
+15 1.33
+15 .66
+15 1.33
+16 .66
+17 1.33 
+17 .66
+15 1.33
+13 .66
+12 1.33
+12 .66
+13 1.33
+7 .66
+8 2

resources/audio/portal.txt

@@ -0,0 +1,124 @@
+
+11 .25
+10 .25
+8 .25
+8 .35  
+10 .4
+ 
+ -50 2.25
+
+1 .25
+11 .25
+10 .25
+8 .25
+8 .5
+10 .5
+ -100 .20
+6 .5
+8 .25
+1 .5
+
+ -50 1.25
+
+1 .25
+8 .5
+10 .25
+11 .75
+8 .25
+5 .5
+6 .75
+8 .5
+1 .25
+1 .5
+10 .5
+
+ -50 2.0
+
+11 .25
+10 .25
+8 .25
+8 .25
+10 .5
+
+ -50 2.25
+
+1 .25
+11 .25
+10 .25
+8 .25
+8 .5
+ -50 .25
+10 .25
+6 .5 
+ -50 .25
+8 .25
+1 .5
+
+ -50 1.5
+
+8 .5
+10 .25
+11 .75
+8 .25
+5 .5
+6 .25
+8 .25
+ -50 .25
+1 .25
+6 .25
+8 .25
+9 .25
+8 .25
+6 .25
+4 .25
+
+ -50 .45
+
+1 .25
+2 .25
+4 .5
+9 .5
+8 .25
+6 .25
+6 .25
+4 .25
+6 .25
+4 .25
+4 .5
+4 .5
+
+1 .25
+2 .25
+4 .5
+9 .5
+11 .25
+9 .25
+8 .25
+6 .25
+6 .25
+8 .25
+9 .5
+9 .5
+
+11 .25
+13 .25
+14 .25
+14 .25
+13 .5
+11 .5
+9 .25
+11 .25
+13 .25
+13 .25
+11 .5
+9 .5
+6 .25
+4 .25
+6 .25
+9 .25
+9 .25
+8 .5
+8 .25
+10 .25
+10 .75
+

resources/audio/tomsdiner.txt

@@ -0,0 +1,72 @@
+0 .2
+2 .1
+3 .3
+7 .2
+
+0 .2
+2 .1
+3 .3
+7 .2
+
+0 .2
+7 .2
+5 .2
+3 .2
+5 .2
+3 .1
+5 .3
+3 .2
+
+0 .2
+2 .1
+3 .3
+7 .2
+
+0 .2
+2 .1
+3 .3
+7 .2
+
+0 .2
+7 .2
+5 .2
+3 .2
+5 .2
+3 .1
+5 .3
+3 .2
+
+3 .2
+0 .2
+-2 .2
+7 .2
+7 .2
+7 .1
+7 .3
+5 .2
+3 .2
+0 .2
+-4 .2
+7 .2
+7 .2
+5 .1
+8 .3
+7 .2
+
+3 .2
+5 .1
+7 .3
+8 .2
+
+3 .2
+5 .1
+7 .3
+8 .2
+
+3 .2
+8 .2
+8 .2
+7 .2
+7 .2
+5 .1
+7 .7

resources/barnsley.txt

@@ -0,0 +1,17 @@
+4
+   0.01  0.85  0.07  0.07
+
+4 3
+   0.00  0.00  0.500
+   0.85  0.04  0.075
+   0.20 -0.26  0.400
+  -0.15  0.28  0.575
+
+4 3
+   0.00  0.16  0.000
+  -0.04  0.85  0.180
+   0.23  0.22  0.045
+   0.26  0.24 -0.086
+
+
+Barnsley's original black spleenwort fern

resources/charges.txt

@@ -0,0 +1,10 @@
+9
+.51 .63 -100
+.50 .50   40
+.50 .72   10
+.33 .33    5
+.20 .20  -10
+.70 .70   10
+.82 .72   20
+.85 .23   30
+.90 .12  -50

resources/coral.txt

@@ -0,0 +1,14 @@
+3
+   0.40  0.15  0.45 
+
+3 3
+   0.307692 -0.531469  0.8863493
+   0.307692 -0.076923  0.2166292
+   0.000000  0.545455  0.0106363
+
+3 3
+  -0.461538 -0.293706  1.0962865
+   0.153846 -0.447552  0.3383760
+   0.692308 -0.195804  0.3808254
+
+coral pattern from Fractint

resources/elements.csv

@@ -0,0 +1,104 @@
+Element,Number,Symbol,Weight,Boil,Melt,Density Vapour,Fusion,
+Hydrogen,1,H,1.01,20.46,13.96,71,0.45,0.06,
+Helium,2,He,4.00,4.26,3.46,126,0.08,0.02,
+Lithium,3,Li,6.94,1603.16,453.66,530,136.01,3.02,
+Beryllium,4,Be,9.01,3043.16,1550.16,1850,309.46,11.73,
+Boron,5,B,10.81,2303.16,2340,536.01,22.19,
+Carbon,6,C,12.01,5103.16,4000.16,2260,719.01,
+Nitrogen,7,N,14.01,77.36,63.16,810,2.79,0.36,
+Oxygen,8,O,16.00,90.16,54.36,1140,3.41,0.22,
+Fluorine,9,F,19.00,84.96,53.56,1505,3.16,0.26,
+Neon,10,Ne,20.18,27.16,24.56,1200,1.77,0.34,
+Sodium,11,Na,22.99,1165.16,370.96,970,101.01,2.60,
+Magnesium,12,Mg,24.31,1380.16,923.16,1740,136.17,8.96,
+Aluminum,13,Al,26.98,2723.16,933.16,2700,284.34,10.68,
+Silicon,14,Si,28.09,2953.16,1683.16,2330,170.02,46.48,
+Phosphorus,15,P,30.98,
+Sulfur,16,S,32.06,717.76,392.16,2070,12.60,1.42,
+Chlorine,17,Cl,35.45,238.46,172.16,1560,10.22,3.22,
+Argon,18,Ar,39.95,87.36,83.76,1400,6.53,1.18,
+Potassium,19,K,39.10,1033.16,336.86,860,79.15,2.30,
+Calcium,20,Ca,40.08,1713.16,1111.16,1550,153.85,8.79,
+Scandium,21,Sc,44.96,3003.16,1812.16,3000,339.20,15.91,
+Titanium,22,Ti,47.90,3533.16,1941.16,4510,445.98,15.49,
+Vanadium,23,V,50.94,3723.16,2173.16,6100,443.89,17.59,
+Chromium,24,Cr,52.00,2938.16,2148.16,7190,305.57,13.82,
+Manganese,25,Mn,54.94,2423.16,1518.16,7430,224.87,14.66,
+Iron,26,Fe,55.85,3273.16,1809.16,7860,354.27,15.37,
+Cobalt,27,Co,58.93,3173.16,1768.16,8900,389.45,15.24,
+Nickel,28,Ni,58.71,3003.16,1726.16,8900,381.07,17.63,
+Copper,29,Cu,63.54,2868.16,1356.16,8960,304.86,13.02,
+Zinc,30,Zn,65.37,1179.16,692.66,7140,114.74,7.37,
+Gallium,31,Ga,69.72,2510.16,302.96,5910,,5.61,
+Germanium,32,Ge,72.59,3103.16,1210.56,5320,284.76,31.83,
+Arsenic,33,As,74.99,886.16,1090.16,5720,32.45,27.72,
+Selenium,34,Se,78.96,958.16,490.16,4790,13.99,5.23,
+Bromine,35,Br,79.91,331.16,265.96,3120,14.99,5.28,
+Krypton,36,Kr,83.80,121.16,115.86,2600,9.05,1.63,
+Rubidium,37,Rb,85.47,961.16,312.06,1530,75.80,2.30,
+Strontium,38,Sr,87.62,1653.16,1041.16,2600,141.54,8.79,
+Yttrium,39,Y,88.91,
+Zirconium,40,Zr,91.22,3853.16,2125.16,6490,502.51,16.75,
+Niobium,41,Nb,92.91,3573.16,2741.16,8400,,26.80,
+Molybdenum,42,Mo,95.94,5833.16,2883.16,10200,536.01,27.64,
+Technetium,43,Tc,96.91,
+Ruthenium,44,Ru,101.07,5173.16,2773.16,12200,619.77,25.54,
+Rhodium,45,Rh,102.90,4773.16,2239.16,12400,531.83,21.78,
+Palladium,46,Pd,106.40,4253.16,1825.16,12000,376.88,16.75,
+Silver,47,Ag,107.87,2483.16,1233.96,10500,254.19,11.31,
+Cadmium,48,Cd,112.40,1038.16,594.06,8650,100.08,6.11,
+Indium,49,In,114.82,2273.16,429.36,7310,224.87,3.27,
+Tin,50,Sn,118.69,2543.16,505.06,7300,293.13,7.20,
+Antimony,51,Sb,121.75,1653.16,903.66,6620,195.14,19.85,
+Tellurium,52,Te,127.60,
+Iodine,53,I,126.90,456.16,386.86,4940,21.78,7.83,
+Xenon,54,Xe,131.30,165.16,161.26,3060,12.65,2.30,
+Cesium,55,Cs,132.90,963.16,301.86,1900,68.26,2.09,
+Barium,56,Ba,137.34,1913.16,987.16,3500,149.50,7.66,
+Lanthanum,57,La,138.91,3743.16,1193.16,6170,402.01,6.28,
+Cerium,58,Ce,140.12,3741.16,1068.16,6670,397.82,5.03,
+Praseodymium,59,Pr,140.91,3400.16,1208.16,6770,330.82,6.70,
+Neodymium,60,Nd,144.24,3300.16,1297.16,7000,288.94,7.12,
+Promethium,61,Pm,144.91,
+Samarium,62,Sm,150.35,2173.16,1345.16,7540,192.63,8.79,
+Europium,63,Eu,151.96,1712.16,1099.16,5260,175.88,9.21,
+Gadolinium,64,Gd,157.25,3273.16,1585.16,7890,301.51,15.49,
+Terbium,65,Tb,158.92,3073.16,1629.16,8270,293.13,16.33,
+Dysprosium,66,Dy,162.50,2873.16,1680.16,8540,280.57,17.17,
+Holmium,67,Ho,164.93,2873.16,1734.16,8800,280.57,17.17,
+Erbium,68,Er,167.26,3173.16,1770.16,9050,280.57,17.17,
+Thulium,69,Tm,168.93,2000.16,1818.16,9330,247.07,18.43,
+Ytterbium,70,Yb,173.04,1700.16,1097.16,6980,159.13,7.54,
+Lutetium,71,Lu,174.97,3600.16,1925.16,9840,376.88,19.26,
+Hafnium,72,Hf,178.49,5673.16,2495.16,13100,649.08,21.78,
+Tantalum,73,Ta,180.95,5698.16,3269.16,16600,753.77,28.48,
+Wolfram,74,W,183.85,6203.16,3683.16,19300,774.71,33.71,
+Rhenium,75,Re,186.20,6173.16,3453.16,21000,636.52,33.08,
+Osmium,76,Os,190.20,5773.16,3273.16,22600,678.39,26.80,
+Iridium,77,Ir,192.22,
+Platinum,78,Pt,195.09,4803.16,2042.16,21400,510.89,19.68,
+Gold,79,Au,196.97,3243.16,1336.16,19300,342.55,12.69,
+Mercury,80,Hg,200.59,630.16,234.76,13600,58.21,2.35,
+Thallium,81,Tl,204.37,1730.16,576.16,11850,162.48,4.27,
+Lead,82,Pb,207.19,1998.16,600.56,11400,176.72,5.11,
+Bismuth,83,Bi,208.98,1833.16,544.46,9800,178.81,10.89,
+Polonium,84,Po,208.98,
+Astatine,85,At,209.99,
+Radon,86,Rn,222.02,
+Francium,87,Fr,223.02,
+Radium,88,Ra,226.00,,973.16,5000,114.74,10.05,
+Actinium,89,Ac,227.03,
+Thorium,90,Th,232.04,4123.16,2023.16,11700,,19.26,
+Protactinium,91,Pa,231.04,
+Uranium,92,U,238.03,4091.16,1405.16,19070,460.64,11.31,
+Neptunium,93,Np,237.00,,910.16,19500,394.89,
+Plutonium,94,Pu,242.00,3508.16,913.16,,365.16,
+Americium,95,Am,243.06,
+Curium,96,Cm,247.07,
+Berkelium,97,Bk,247.07,
+Californium,98,Cf,251.08,
+Einsteinium,99,Es,254.09,
+Fermium,100,Fm,257.10,
+Mendelevium,101,Md,257.10,
+Nobelium,102,No,255.09,
+Lawrencium,103,Lr,256.10,

resources/example.txt

@@ -0,0 +1 @@
+aacaagtttacaagc

resources/genome15.txt

@@ -0,0 +1 @@
+AACAAGTTTACAAGC

resources/genomeA.txt

@@ -0,0 +1 @@
+ATAGATGCATAGCGCATAGC

resources/genomeTiny.txt

@@ -0,0 +1 @@
+ATAGATGCATAGCGCATAGCTAGATGTGCTAGC

resources/in1.txt

@@ -0,0 +1 @@
+This is

resources/in2.txt

@@ -0,0 +1,2 @@
+a tiny
+test.

resources/ip.csv

@@ -0,0 +1,460 @@
+www.princeton.edu,128.112.128.15
+www.cs.princeton.edu,128.112.136.35
+www.math.princeton.edu,128.112.18.11
+www.cs.harvard.edu,140.247.50.127
+www.harvard.edu,128.103.60.24
+www.yale.edu,130.132.51.8
+www.econ.yale.edu,128.36.236.74
+www.cs.yale.edu,128.36.229.30
+espn.com,199.181.135.201
+yahoo.com,66.94.234.13
+msn.com,207.68.172.246
+google.com,64.233.167.99
+baidu.com,202.108.22.33
+yahoo.co.jp,202.93.91.141
+sina.com.cn,202.108.33.32
+ebay.com,66.135.192.87
+sohu.com,61.135.133.103
+163.com,220.181.29.154
+passport.net,65.54.179.226
+qq.com,219.133.40.91
+amazon.com,72.21.203.1
+myspace.com,216.178.32.48
+microsoft.com,207.46.197.32
+taobao.com,60.191.55.43
+naver.com,222.122.84.200
+google.co.jp,66.102.7.104
+google.co.uk,66.249.93.104
+3721.com,202.165.98.249
+aol.com,64.12.50.151
+yahoo.com.cn,202.165.102.205
+bbc.co.uk,212.58.228.155
+alibaba.com,199.106.69.11
+go.com,199.181.132.123
+tom.com,61.135.158.237
+nate.com,203.226.253.11
+cnn.com,64.236.16.20
+daum.net,211.115.77.211
+blogger.com,66.102.15.100
+fastclick.com,205.180.86.4
+wikipedia.org,66.230.200.100
+rakuten.co.jp,202.72.51.22
+ebay.co.uk,66.135.192.41
+craigslist.org,66.150.253.241
+yisou.com,202.165.102.114
+chinaren.com,61.135.133.103
+livedoor.com,203.131.197.197
+google.de,66.249.93.104
+google.es,66.249.93.104
+imdb.com,72.21.206.75
+google.ca,64.233.161.104
+google.com.tr,66.249.93.104
+adultfriendfinder.com,64.56.205.72
+comcast.net,63.240.76.72
+mop.com,61.135.170.231
+xanga.com,38.101.169.15
+china.com,61.151.243.196
+126.com,61.177.95.155
+ebay.com.cn,66.135.192.23
+sogou.com,61.135.134.100
+apple.com,17.254.3.183
+mixi.jp,59.106.41.69
+zhongsou.com,202.108.33.134
+hao123.com,61.135.163.54
+msn.co.jp,207.46.78.170
+xinhuanet.com,202.108.119.193
+dell.com,143.166.83.38
+mediaplex.com,64.70.54.41
+goo.ne.jp,210.165.9.195
+google.fr,66.249.93.104
+21cn.com,61.140.60.90
+casalemedia.com,216.220.63.250
+infoseek.co.jp,202.232.118.11
+ebay.de,66.135.192.71
+weather.com,63.111.24.22
+overture.com,63.163.102.248
+about.com,207.241.148.80
+pchome.com.tw,210.59.230.60
+soufun.com,202.108.253.57
+mapquest.com,64.12.50.151
+pconline.com.cn,61.145.113.47
+chinabbs.com,61.129.117.204
+hi5.com,204.13.51.241
+nytimes.com,199.239.136.200
+amazon.co.jp,207.171.181.135
+265.com,219.234.85.197
+cnet.com,216.239.113.101
+orkut.com,72.14.209.85
+hc360.com,203.134.241.17
+thefacebook.com,204.15.20.25
+blogchina.com,60.191.254.42
+gator.com,64.152.73.182
+match.com,216.178.176.11
+mynet.com,212.101.97.6
+cmfu.com,221.231.128.79
+google.com.au,66.102.7.104
+google.com.sa,64.233.161.104
+bankofamerica.com,171.159.65.173
+google.it,66.249.93.104
+tribalfusion.com,204.11.109.133
+sina.com,71.5.7.138
+msn.com.cn,207.46.78.244
+free.fr,212.27.48.10
+fc2.com,66.160.207.124
+neopets.com,206.132.214.10
+flickr.com,68.142.214.24
+friendster.com,209.11.168.242
+uol.com.br,200.221.2.45
+doubleclick.com,216.73.92.112
+download.com,216.239.113.101
+allyes.com,61.152.242.212
+earthlink.net,209.86.93.201
+webshots.com,216.239.124.149
+cnnic.net.cn,159.226.202.44
+kingsoft.com,218.30.82.62
+mywebsearch.com,207.159.120.154
+myway.com,208.45.133.133
+amazon.co.uk,87.238.81.129
+theplanet.com,70.87.6.11
+revenue.net,204.13.160.23
+walmart.com,161.170.244.20
+macromedia.com,192.150.18.118
+nifty.com,202.248.237.232
+hp.com,192.6.165.40
+target.com,161.225.130.95
+rediff.com,207.126.99.156
+yesky.com,219.239.88.110
+statcounter.com,66.98.134.100
+sourceforge.net,66.35.250.203
+geocities.com,66.218.77.68
+ups.com,153.2.224.50
+netscape.com,152.163.211.51
+cctv.com,202.108.249.209
+2ch.net,206.223.157.122
+overstock.com,67.110.108.250
+51job.com,61.129.48.158
+livejournal.com,204.9.177.18
+people.com.cn,202.99.23.208
+sportsline.com,64.30.236.34
+monster.com,63.112.169.1
+googlesyndication.com,216.239.37.99
+walla.co.il,192.118.82.140
+reference.com,66.161.12.84
+youthwant.com.tw,203.133.10.2
+homeway.com.cn,60.28.250.193
+archive.org,207.241.233.58
+starware.com,64.94.162.226
+chinaz.com,222.88.88.166
+phoenixtv.com,210.51.8.238
+usps.com,56.0.66.100
+ask.com,65.214.39.56
+lycos.com,209.202.230.30
+zedo.com,64.41.197.46
+expedia.com,216.251.114.10
+bestbuy.com,209.170.113.6
+excite.co.jp,210.150.160.234
+photobucket.com,66.11.50.5
+foxsports.com,204.120.182.79
+netflix.com,216.35.131.200
+iask.com,202.108.43.207
+nastydollars.com,64.7.203.60
+winfixer.com,89.149.196.161
+google.co.in,66.249.93.104
+nba.com,63.240.105.137
+verycd.com,58.218.179.162
+enet.com.cn,219.239.89.10
+google.nl,66.249.93.104
+avl.com.cn,202.103.134.198
+tripod.com,209.202.226.20
+focus.cn,61.135.134.226
+netmarble.net,222.122.134.40
+terra.com.br,200.176.3.142
+paypopup.com,66.48.78.201
+sitesell.com,216.95.221.39
+altavista.com,66.94.234.13
+gmx.net,213.165.65.50
+ebay.com.au,66.135.192.72
+msn.com.tw,207.46.78.247
+aebn.net,64.132.43.67
+linksynergy.com,216.35.71.96
+google.co.il,66.249.93.104
+ev1servers.net,207.218.223.142
+net-offers.net,209.133.35.202
+wanadoo.fr,193.252.122.103
+imageshack.us,38.99.76.22
+tianya.cn,218.77.130.14
+yandex.ru,213.180.204.11
+auction.co.kr,211.233.17.11
+yam.com,211.72.254.6
+itsun.com,218.83.154.182
+google.com.br,64.233.161.104
+www.net.cn,218.30.103.40
+dmoz.org,207.200.81.154
+chinamobile.com,211.136.27.3
+online.sh.cn,61.129.163.65
+maktoob.com,66.70.92.80
+circuitcity.com,12.26.69.95
+washingtonpost.com,12.129.147.65
+miniclip.com,66.165.172.181
+rapidshare.de,130.117.156.32
+adobe.com,192.150.18.60
+gmarket.co.kr,211.115.74.50
+nfl.com,64.30.236.34
+excite.com,208.45.133.23
+hangame.co.jp,203.192.145.126
+wenxuecity.com,63.166.3.19
+tigerdirect.com,199.181.77.35
+ig.com.br,200.226.133.74
+ebay.ca,66.135.192.35
+chinahr.com,211.151.252.200
+mail.ru,194.67.57.26
+google.com.sg,66.102.7.104
+symantec.com,206.204.52.54
+msn.es,213.199.158.22
+pornaccess.com,66.152.91.88
+zaobao.com,202.27.17.227
+ynet.co.il,192.115.80.66
+ign.com,216.35.123.102
+gamespot.com,216.239.113.172
+pogo.com,159.153.235.12
+milliyet.com.tr,213.243.28.4
+typepad.com,204.9.178.11
+elmundo.es,193.110.128.200
+zol.com.cn,211.154.205.43
+usatoday.com,209.97.46.5
+orbitz.com,65.216.67.53
+skype.com,198.173.5.35
+travelocity.com,151.193.224.81
+donews.com,211.100.32.211
+msn.co.uk,213.199.158.22
+ameblo.jp,203.80.26.36
+noaa.gov,140.90.33.10
+google.com.tw,66.102.7.104
+ibm.com,129.42.16.103
+sayclub.com,222.231.20.16
+poptang.com,61.152.103.196
+btchina.net,61.152.144.243
+bellsouth.net,216.77.188.41
+fedex.com,199.81.198.50
+whois.sc,66.249.4.251
+onlinedown.net,218.93.205.59
+netzero.net,64.136.21.230
+careerbuilder.com,64.88.161.59
+shopping.com,64.74.210.80
+ninemsn.com.au,202.58.56.1
+hkjc.com,203.215.253.134
+citysearch.com,209.104.35.228
+chinacars.com,222.73.248.23
+pricegrabber.com,64.156.13.20
+amazon.de,87.238.81.130
+pcpop.com,61.55.138.205
+hatena.ne.jp,221.186.146.27
+seesaa.net,59.106.28.131
+aljazeera.net,12.120.9.56
+windowsmedia.com,207.46.196.100
+virgilio.it,212.48.10.150
+tianyaclub.com,218.77.130.14
+google.se,66.249.93.104
+bizrate.com,216.52.244.254
+kinghost.com,38.102.66.46
+atnext.com,202.85.162.155
+constantcontact.com,63.251.135.71
+skycn.com,222.185.229.78
+forbes.com,63.240.4.179
+empas.com,61.97.66.4
+internet-optimizer.com,65.39.191.5
+foxnews.com,61.120.150.14
+sina.com.hk,202.85.139.140
+everythinggirl.com,199.89.199.26
+drudgereport.com,38.99.110.60
+xilu.com,219.235.232.238
+indiatimes.com,203.199.93.39
+realtor.com,206.131.180.21
+belnk.com,64.152.73.214
+sakura.ne.jp,210.188.224.131
+icq.com,64.12.164.247
+secureserver.net,64.202.188.208
+qihoo.com,220.181.32.27
+t-online.de,62.153.159.92
+nexon.com,220.90.205.55
+discuss.com.hk,59.188.17.132
+google.com.mx,64.233.161.104
+libero.it,195.210.91.83
+fares.net,66.98.148.128
+9you.com,61.129.90.134
+xrea.com,210.153.88.114
+adserver.com,205.180.86.20
+reuters.com,64.39.47.104
+qianlong.com,60.28.241.33
+fc2web.com,66.160.207.226
+evite.com,209.104.61.200
+hurriyetim.com.tr,213.243.16.135
+ofoto.com,64.209.168.84
+tradedoubler.com,217.212.240.170
+skyblog.com,212.129.63.31
+real.com,207.188.7.118
+cnool.net,61.153.17.116
+dangdang.com,211.100.16.137
+whitepages.com,64.124.61.10
+dreamwiz.com,211.39.128.129
+clickbank.com,64.128.87.137
+digitalpoint.com,216.9.35.56
+msn.de,213.199.158.22
+so-net.ne.jp,202.238.95.65
+americanexpress.com,12.29.100.148
+guardian.co.uk,212.187.153.30
+onet.pl,213.180.130.200
+marketwatch.com,205.203.131.32
+webmasterworld.com,72.3.232.139
+blocket.se,195.149.144.146
+att.net,204.127.135.135
+freewebs.com,38.103.0.2
+1ting.com,202.101.42.28
+bangbros1.com,66.230.182.98
+paran.com,211.41.69.111
+voyeurweb.com,63.243.140.30
+cafepress.com,128.242.99.106
+spiegel.de,195.71.11.67
+cartoonnetwork.com,64.236.22.72
+jrj.com.cn,211.157.29.11
+msn.fr,213.199.158.22
+eastday.com,61.129.65.6
+aftonbladet.se,192.71.238.76
+it168.com,202.106.124.46
+cmbchina.com,61.144.209.195
+answers.com,64.29.209.117
+superpages.com,151.138.2.30
+jcpenney.com,146.235.66.32
+networksolutions.com,205.178.187.13
+google.com.gr,66.249.93.104
+msn.com.br,65.54.211.61
+warnerbros.com,64.12.46.148
+exblog.jp,210.150.29.30
+tripadvisor.com,66.150.117.31
+blogcn.com,61.155.107.199
+gnavi.co.jp,211.13.222.21
+51yes.com,58.215.75.45
+adbrite.com,64.127.126.24
+godaddy.com,64.202.188.201
+google.be,66.249.93.104
+mag2.com,210.171.134.166
+aweber.com,207.106.239.74
+google.com.ar,64.233.161.104
+ikea.com,192.71.68.7
+udn.com,210.243.166.43
+rambler.ru,81.19.70.3
+xici.net,211.151.230.73
+google.ae,66.249.93.104
+juno.com,64.136.21.200
+mlb.com,63.240.10.41
+sears.com,64.73.155.29
+biz178.com,60.28.24.70
+bdchina.com,218.59.169.109
+iwon.com,208.45.133.25
+chosun.com,203.255.99.221
+newegg.com,216.52.208.187
+verizon.net,206.46.230.37
+freepornofreeporn.com,66.152.88.203
+kooora.com,69.59.144.138
+megaupload.com,69.5.88.72
+americangreetings.com,216.33.97.70
+ebay.fr,66.135.192.40
+pcauto.com.cn,61.145.113.47
+ezboard.com,209.66.118.15
+cingular.com,135.209.224.190
+6park.com,70.85.39.9
+wannawatch.com,64.255.170.250
+infospace.com,206.29.192.200
+readnovel.com,61.51.18.32
+ctrip.com,218.244.111.3
+videosz.com,66.55.135.134
+vnexpress.net,210.245.0.21
+impress.co.jp,210.173.173.19
+freeservers.com,64.136.25.175
+msn.com.tr,213.199.158.22
+pchome.net,202.109.72.72
+keyrun.com,59.34.148.225
+cox.net,68.1.17.9
+allabout.co.jp,202.222.83.1
+mofcom.gov.cn,211.88.2.44
+barnesandnoble.com,65.167.9.21
+mail2web.com,168.144.1.11
+sdo.com,61.172.251.58
+myrice.com,61.152.117.30
+boston.com,66.151.183.21
+victoriassecret.com,209.170.113.7
+web.de,217.72.195.42
+wsj.com,206.157.193.68
+classmates.com,65.243.133.81
+sooe.cn,202.108.43.82
+eastmoney.com,222.73.4.138
+weatherbug.com,8.15.14.12
+oingo.com,216.239.37.99
+dmm.co.jp,202.6.246.3
+im286.com,210.51.170.68
+ourgame.com,202.108.36.77
+ebaumsworld.com,4.78.57.55
+yonja.com,208.185.251.23
+google.co.th,64.233.161.104
+cj.com,64.70.54.78
+google.ch,66.249.93.104
+enorth.com.cn,61.136.63.71
+made-in-china.com,72.32.124.214
+ticketmaster.com,209.104.46.141
+sogua.com,59.39.62.38
+sony.com,160.33.26.10
+a8.net,202.177.198.81
+google.dk,66.249.93.104
+kakaku.com,210.189.92.161
+istockphoto.com,206.174.193.106
+sex141.com,210.245.162.226
+trafficmp.com,65.216.123.160
+zhaopin.com,211.99.188.197
+uwants.com,59.188.4.76
+hawaaworld.com,193.138.222.218
+bravenet.com,65.39.176.100
+rn11.com,196.3.220.4
+joyo.com,125.35.1.169
+com.com,216.239.113.101
+multimap.com,217.150.126.210
+advnt01.com,66.194.38.28
+terra.es,213.4.130.210
+slashdot.org,66.35.250.150
+hotornot.com,66.151.156.188
+match100.cn,218.244.143.87
+studiotraffic.com,38.96.5.148
+msn.se,213.199.158.22
+passion.com,209.185.12.52
+51sobu.com,218.83.152.111
+tk4479.com,60.191.249.35
+dpreview.com,198.64.145.21
+deviantart.com,69.28.181.43
+globo.com,201.7.176.59
+123greetings.com,72.36.229.12
+cnzz.com,222.77.187.123
+naukri.com,198.64.153.138
+ca.gov,63.196.102.5
+southwest.com,12.5.136.100
+mail.com,205.158.62.116
+dealtime.com,64.74.210.79
+6arab.com,64.27.7.67
+ebay.it,66.135.192.24
+sanook.com,58.181.243.6
+news.com.au,202.139.106.174
+haberturk.com,89.106.24.34
+screensavers.com,198.65.220.236
+google.com.hk,66.102.7.104
+hotjobs.com,66.218.84.150
+livescore.com,64.49.221.121
+costco.com,170.167.8.1
+no-ip.com,204.16.252.112
+gamefaqs.com,216.239.113.186
+blockbuster.com,129.33.92.70
+wwe.com,64.152.4.85
+capitalone.com,199.244.218.42
+sun.com,72.5.124.61
+epinions.com,64.74.210.45
+msn.co.il,192.117.152.14
+ahram.org.eg,163.121.116.22
+fatwallet.com,216.138.164.31
+aim.com,64.12.50.151

resources/mandel.txt

@@ -0,0 +1,256 @@
+0 0 0
+0 0 168
+0 168 0
+0 168 168
+168 0 0
+168 0 168
+168 84 0
+168 168 168
+84 84 84
+84 84 252
+84 252 84
+84 252 252
+252 84 84
+252 84 252
+252 252 84
+252 252 252
+0 0 0
+20 20 20
+32 32 32
+44 44 44
+56 56 56
+68 68 68
+80 80 80
+96 96 96
+112 112 112
+128 128 128
+144 144 144
+160 160 160
+180 180 180
+200 200 200
+224 224 224
+252 252 252
+0 0 252
+64 0 252
+124 0 252
+188 0 252
+252 0 252
+252 0 188
+252 0 124
+252 0 64
+252 0 0
+252 64 0
+252 124 0
+252 188 0
+252 252 0
+188 252 0
+124 252 0
+64 252 0
+0 252 0
+0 252 64
+0 252 124
+0 252 188
+0 252 252
+0 188 252
+0 124 252
+0 64 252
+124 124 252
+156 124 252
+188 124 252
+220 124 252
+252 124 252
+252 124 220
+252 124 188
+252 124 156
+252 124 124
+252 156 124
+252 188 124
+252 220 124
+252 252 124
+220 252 124
+188 252 124
+156 252 124
+124 252 124
+124 252 156
+124 252 188
+124 252 220
+124 252 252
+124 220 252
+124 188 252
+124 156 252
+180 180 252
+196 180 252
+216 180 252
+232 180 252
+252 180 252
+252 180 232
+252 180 216
+252 180 196
+252 180 180
+252 196 180
+252 216 180
+252 232 180
+252 252 180
+232 252 180
+216 252 180
+196 252 180
+180 252 180
+180 252 196
+180 252 216
+180 252 232
+180 252 252
+180 232 252
+180 216 252
+180 196 252
+0 0 112
+28 0 112
+56 0 112
+84 0 112
+112 0 112
+112 0 84
+112 0 56
+112 0 28
+112 0 0
+112 28 0
+112 56 0
+112 84 0
+112 112 0
+84 112 0
+56 112 0
+28 112 0
+0 112 0
+0 112 28
+0 112 56
+0 112 84
+0 112 112
+0 84 112
+0 56 112
+0 28 112
+56 56 112
+68 56 112
+84 56 112
+96 56 112
+112 56 112
+112 56 96
+112 56 84
+112 56 68
+112 56 56
+112 68 56
+112 84 56
+112 96 56
+112 112 56
+96 112 56
+84 112 56
+68 112 56
+56 112 56
+56 112 68
+56 112 84
+56 112 96
+56 112 112
+56 96 112
+56 84 112
+56 68 112
+80 80 112
+88 80 112
+96 80 112
+104 80 112
+112 80 112
+112 80 104
+112 80 96
+112 80 88
+112 80 80
+112 88 80
+112 96 80
+112 104 80
+112 112 80
+104 112 80
+96 112 80
+88 112 80
+80 112 80
+80 112 88
+80 112 96
+80 112 104
+80 112 112
+80 104 112
+80 96 112
+80 88 112
+0 0 64
+16 0 64
+32 0 64
+48 0 64
+64 0 64
+64 0 48
+64 0 32
+64 0 16
+64 0 0
+64 16 0
+64 32 0
+64 48 0
+64 64 0
+48 64 0
+32 64 0
+16 64 0
+0 64 0
+0 64 16
+0 64 32
+0 64 48
+0 64 64
+0 48 64
+0 32 64
+0 16 64
+32 32 64
+40 32 64
+48 32 64
+56 32 64
+64 32 64
+64 32 56
+64 32 48
+64 32 40
+64 32 32
+64 40 32
+64 48 32
+64 56 32
+64 64 32
+56 64 32
+48 64 32
+40 64 32
+32 64 32
+32 64 40
+32 64 48
+32 64 56
+32 64 64
+32 56 64
+32 48 64
+32 40 64
+44 44 64
+48 44 64
+52 44 64
+60 44 64
+64 44 64
+64 44 60
+64 44 52
+64 44 48
+64 44 44
+64 48 44
+64 52 44
+64 60 44
+64 64 44
+60 64 44
+52 64 44
+48 64 44
+44 64 44
+44 64 48
+44 64 52
+44 64 60
+44 64 64
+44 60 64
+44 52 64
+44 48 64
+0 0 0
+0 0 0
+0 0 0
+0 0 0
+0 0 0
+0 0 0
+0 0 0
+0 0 0

resources/medium.txt

@@ -0,0 +1,52 @@
+50
+ 0  7    0 34   
+ 1 14    1 22    1 22    1 45
+ 2 19    2 25    2 33 
+ 3  4    3 17    3 27    3 36    3 42
+ 4 17    4 17    4 27    4 27
+ 5 43
+ 6 13    6 13    6 28
+ 7 41
+ 8 19    8 48
+ 9 11    9 30    9 46
+10  0   19  7   10 28   10 28   10 28   10 29   10 29   10 41
+11 21   11 30
+12  9   12 11   12 21   12 21   12 26   12 26
+13 22   13 23   13 47
+14  8   14 48
+15 34   15 49
+16  9
+17 20   17 24   17 38
+18  6   18 28   18 32   18 42
+19 15   19 40
+20  3   20 35   20 36   20 46
+21  1   21 14   21 22
+22  6 
+23 11   23 21   23 22
+24  4   24  5   24 38
+25 34
+26  9   26 26   26 48
+27  5   27 24   27 31
+28 22   28 39   28 44
+29 49   29 22
+30 23   30 37
+31 18   31 32
+32  5   32  6   32 13   32 27   32 37   32 47
+33  8   33 19
+34  2   34 19   34 40
+35  9   35 46
+36 42
+37  5   37 9    37 35   37 35   37 47
+38 35   38 37
+39 18   39 42
+40 15
+41 28   41 44
+42 31
+43 24   43 37   43 38
+44  7   44 39
+45  8   45 14   45 14   45 15   45 49
+46 16
+47 23   47 30
+48 12   48 21   48 33   48 33
+49  1   49 34   49 22
+

resources/routes.txt

@@ -0,0 +1,17 @@
+JFK MCO
+ORD DEN
+ORD HOU    
+ATL MCO
+ORD HOU
+DFW PHX    
+JFK ATL
+ORD DFW
+ORD PHX    
+ATL HOU
+DEN PHX
+PHX LAX    
+JFK ORD
+DEN LAS
+DFW HOU    
+ORD ATL
+LAS LAX

resources/sierpinski.txt

@@ -0,0 +1,10 @@
+3   
+  .33 .33 .34 
+3 3 
+  .50 .00 .00 
+  .50 .00 .50 
+  .50 .00 .25 
+3 3 
+  .00 .50 .00 
+  .00 .50 .00 
+  .00 .50 .433 

resources/test.txt

@@ -0,0 +1,9 @@
+bob@office
+carl@beach
+marvin@spam
+bob@office
+bob@office
+mallory@spam
+dave@boat
+eve@airport
+alice@home 

resources/test5.txt

@@ -0,0 +1,6 @@
+5 5
+0 1 1 0 1
+0 0 1 1 1
+1 1 0 1 1
+1 0 0 0 1
+0 1 1 1 1

resources/test8.txt

@@ -0,0 +1,9 @@
+8 8
+0 0 1 1 1 0 0 0
+1 0 0 1 1 1 1 1
+1 1 1 0 0 1 1 0
+0 0 1 1 0 1 1 1
+0 1 1 1 0 1 1 0
+0 1 0 0 0 0 1 1
+1 0 1 0 1 1 1 1
+1 1 1 1 0 1 0 0

resources/testEZ.txt

@@ -0,0 +1,6 @@
+5 5
+0 1 1 0 1
+0 0 1 1 1
+1 1 0 1 1
+1 0 0 0 1
+0 1 1 1 1

resources/tiny.txt

@@ -0,0 +1,2 @@
+was had him and you his the but
+

resources/tiny2.txt

@@ -0,0 +1,7 @@
+A B 
+A C 
+C A 
+C G 
+A G 
+H A 
+

resources/tobe.txt

@@ -0,0 +1 @@
+to be or not to - be - - that - - - is 

resources/tree.txt

@@ -0,0 +1,20 @@
+6
+   0.1  0.1  0.2  0.2  0.2  0.2 
+
+6 3
+   0.00  0.00  0.550
+  -0.05  0.00  0.525
+   0.46 -0.15  0.270
+   0.47 -0.15  0.265
+   0.43  0.28  0.285
+   0.42  0.26  0.290
+
+6 3
+   0.00  0.60  0.000
+  -0.50  0.00  0.750
+   0.39  0.38  0.105
+   0.17  0.42  0.465
+  -0.25  0.45  0.625
+  -0.35  0.31  0.525
+
+a tree

resources/whitelist.txt

@@ -0,0 +1,4 @@
+alice@home
+bob@office
+carl@beach
+dave@boat

src/audio/PlayThatTune.java

@@ -0,0 +1,42 @@
+package audio;
+
+import java.io.IOException;
+
+import stdlib.StdAudio;
+import stdlib.StdIn;
+
+/**
+ * This is a data-driven program that plays pure tones from
+ * the notes on the chromatic scale, specified on standard input
+ * by their distance from concert A.
+ * % java PlayThatTune < elise.txt
+ * @author Daniel Weschke
+ */
+public class PlayThatTune {
+
+    public static void main(String[] args) throws IOException {
+    	if(args.length == 0) return;
+
+        // repeat as long as there are more integers to read in
+        while(!StdIn.isEmpty()) {
+
+            // read in the pitch, where 0 = Concert A (A4)
+            int pitch = StdIn.readInt();
+
+            // read in duration in seconds
+            double duration = StdIn.readDouble();
+
+            // build sine wave with desired frequency
+            double hz = 440 * Math.pow(2, pitch / 12.0);
+            int N = (int) (StdAudio.SAMPLE_RATE * duration);
+            double[] a = new double[N+1];
+            int i;
+            for(i=0; i<=N; i++) {
+                a[i] = Math.sin(2 * Math.PI * i * hz / StdAudio.SAMPLE_RATE);
+            }
+
+            // play it using standard audio
+            StdAudio.play(a);
+        }
+    }
+}

src/audio/PlayThatTuneDeluxe.java

@@ -0,0 +1,82 @@
+package audio;
+
+import stdlib.StdAudio;
+import stdlib.StdIn;
+
+
+/*************************************************************************
+ *  Compilation:  javac PlayThatTuneDeluxe.java
+ *  Execution:    java PlayThatTuneDeluxe < data.txt
+ *
+ *  % java PlayThatTuneDeluxe 0.5 < elise.txt
+ *
+ *  Data files
+ *  ----------
+ *  http://www.cs.princeton.edu/introcs/21function/elise.txt
+ *  http://www.cs.princeton.edu/introcs/21function/99luftballons.txt
+ *  http://www.cs.princeton.edu/introcs/21function/freebird.txt
+ *  http://www.cs.princeton.edu/introcs/21function/Ascale.txt
+ *  http://www.cs.princeton.edu/introcs/21function/National_Anthem.txt
+ *  http://www.cs.princeton.edu/introcs/21function/looney.txt
+ *  http://www.cs.princeton.edu/introcs/21function/StairwayToHeaven.txt
+ *  http://www.cs.princeton.edu/introcs/21function/entertainer.txt
+ *  http://www.cs.princeton.edu/introcs/21function/old-nassau.txt
+ *  http://www.cs.princeton.edu/introcs/21function/arabesque.txt
+ *  http://www.cs.princeton.edu/introcs/21function/firstcut.txt
+ *  http://www.cs.princeton.edu/introcs/21function/tomsdiner.txt
+ *  http://www.cs.princeton.edu/introcs/21function/portal.txt
+ *
+ *************************************************************************/
+
+public class PlayThatTuneDeluxe {
+
+    // take weighted sum of two arrays
+    public static double[] sum(double[] a, double[] b, double awt, double bwt) {
+
+        // precondition: arrays have the same length
+        assert (a.length == b.length);
+
+        // compute the weighted sum
+        double[] c = new double[a.length];
+        for (int i = 0; i < a.length; i++) {
+            c[i] = a[i]*awt + b[i]*bwt;
+        }
+        return c;
+    } 
+
+    // create a pure tone of the given frequency for the given duration
+    public static double[] tone(double hz, double duration) { 
+        int N = (int) (StdAudio.SAMPLE_RATE * duration);
+        double[] a = new double[N+1];
+        for (int i = 0; i <= N; i++) {
+            a[i] = Math.sin(2 * Math.PI * i * hz / StdAudio.SAMPLE_RATE);
+        }
+        return a; 
+    } 
+
+    // create a note with harmonics of of the given pitch, where 0 = concert A
+    public static double[] note(int pitch, double t) {
+        double hz = 440.0 * Math.pow(2, pitch / 12.0);
+        double[] a  = tone(hz, t);
+        double[] hi = tone(2*hz, t);
+        double[] lo = tone(hz/2, t);
+        double[] h  = sum(hi, lo, .5, .5);
+        return sum(a, h, .5, .5);
+    }
+
+
+    // read in notes from standard input and play them on standard audio
+    public static void main(String[] args) {
+
+        // read in pitch-duration pairs from standard input
+        while (!StdIn.isEmpty()) {
+            int pitch = StdIn.readInt();
+            double duration = StdIn.readDouble();
+            double[] a = note(pitch, duration);
+            StdAudio.play(a);
+        }
+
+        // needed to terminate program - known Java bug
+        System.exit(0);
+    } 
+}

src/audio/Scale.java

@@ -0,0 +1,36 @@
+package audio;
+
+import stdlib.StdAudio;
+
+
+/**
+ * Plays an A major scale
+ */
+public class Scale {
+
+    // create a pure tone of the given frequency for the given duration
+    public static double[] tone(double hz, double duration) { 
+        int N = (int) (StdAudio.SAMPLE_RATE * duration);
+        double[] a = new double[N+1];
+        for (int i = 0; i <= N; i++) {
+            a[i] = Math.sin(2 * Math.PI * i * hz / StdAudio.SAMPLE_RATE);
+        }
+        return a; 
+    } 
+
+
+    // test client - A major scale
+    public static void main(String[] args) {
+
+        // scale increments
+        int[] steps = { 0, 2, 4, 5, 7, 9, 11, 12 };
+        for (int i = 0; i < steps.length; i++) {
+            double hz = 440.0 * Math.pow(2, steps[i] / 12.0);
+            StdAudio.play(tone(hz, 1.0));
+        }
+
+        // needed because of the way Java handles audio
+        System.exit(0);
+    }
+}
+

src/audio/package-info.java

@@ -0,0 +1,6 @@
+/**
+ * Acoustic
+ * 
+ * @author Daniel Weschke
+ */
+package audio;

src/awt/Arrow.java

@@ -0,0 +1,154 @@
+package awt;
+
+import java.awt.BasicStroke;
+import java.awt.Color;
+import java.awt.Graphics;
+import java.awt.Graphics2D;
+import java.awt.Polygon;
+
+/**
+ * Hinzufügen von Pfeilen auf Grafikkontext Graphics g.
+ * @author Daniel Weschke
+ *
+ */
+public class Arrow {
+	/**
+	 * <20>fnnungswinkel der Pfeilspitze
+	 */
+	private double ang;
+	
+	/**
+	 * L<>nge der Pfeilspitze
+	 */
+	private double length;
+	
+	private Color color;
+
+	/**
+	 * Konstruktor mit default-Werten.
+	 * Spitze 10 px, Winkel 20<32> und Farbe dunkel grau.
+	 */
+	Arrow() {
+		length = 10;
+		ang = 20*Math.PI/180;
+		color = new Color(80,80,80);
+	}
+	
+	/**
+	 * Form der Pfeilspitze setzen.
+	 * <20>fnnungswinkel min. 5<>, L<>nge min. 5 px.
+	 * @param a <20>fnnungswinkel der Pfeilspitze
+	 * @param len L<>nge der Pfeilspitze
+	 */
+	public void setShape(double a, double len) {
+		ang = a;       if(ang<5) ang=5;
+		ang *= Math.PI/180;
+		length = len;  if(len<5) len=5;
+	}
+
+	/**
+	 * Farbe nach RGB-Anteile setzen.
+	 * @param r Rotanteil
+	 * @param g Gr<47>nanteil
+	 * @param b Blauanteil
+	 */
+	public void setColor(int r, int g, int b) { color = new Color(r,g,b); }
+
+	/**
+	 * Farbe setzen.
+	 * @param col Color-Objekt
+	 */
+	public void setColor(Color col) { color = col; }
+
+	/**
+	 * Pfeil zeichnen. Vom Anfangspunkt x0, y0 zum Endpunkt x1, y1.
+	 * @param g Grafikkontext
+	 * @param x0 Startwert x
+	 * @param y0 Startwert y
+	 * @param x1 Endwert x
+	 * @param y1 Endwert y
+	 */
+	public void draw(Graphics g, double x0, double y0, double x1, double y1){
+		// in Pfeilrichtung; rechts Punkt 2, links Punkt 3
+	    int ix2, iy2, ix3, iy3;
+	    double sinPhi, cosPhi, dx, dy, x, y, s;
+	    dx = x1-x0;
+	    dy = y1-y0;
+	    s = Math.sqrt(dy*dy+dx*dx);
+	    sinPhi = dy/s;
+	    cosPhi = dx/s;
+	    if(s<length) {
+	    	x0 = x1 - length*cosPhi;
+	    	y0 = y1 - length*sinPhi;
+	    }
+	    x = -length*Math.cos(ang);
+	    y =  length*Math.sin(ang);
+	    ix2 = (int)(x1 + x*cosPhi - y*sinPhi);
+	    iy2 = (int)(y1 + x*sinPhi + y*cosPhi);
+	    ix3 = (int)(x1 + x*cosPhi + y*sinPhi);
+	    iy3 = (int)(y1 + x*sinPhi - y*cosPhi);
+	    Color c = g.getColor();
+	    g.setColor(color);
+	    g.drawLine((int)x0,(int)y0,(int)x1,(int)y1);
+	    g.drawLine(ix2,iy2,(int)x1,(int)y1);
+	    g.drawLine(ix3,iy3,(int)x1,(int)y1);
+	    g.setColor(c);
+	}
+	public void drawBoth(Graphics g, double x0, double y0, double x1, double y1){
+	    double sinPhi, cosPhi, dx, dy, x, y, s;
+	    dx = x1 - x0;
+	    dy = y1 - y0;
+	    s = Math.sqrt(dy*dy+dx*dx);
+	    sinPhi = dy/s;
+	    cosPhi = dx/s;
+	    if(s<length) {
+	      x0 = x1 - length*cosPhi;
+	      y0 = y1 - length*sinPhi;
+	    }
+	    x = -length*Math.cos(ang);
+	    y =  length*Math.sin(ang);
+	    draw(g, x0, y0, x1, y1);
+	    int ix22, iy22, ix32, iy32;
+	    ix22 = (int)(x0 - x*cosPhi + y*sinPhi);
+	    iy22 = (int)(y0 - x*sinPhi - y*cosPhi);
+	    ix32 = (int)(x0 - x*cosPhi - y*sinPhi);
+	    iy32 = (int)(y0 - x*sinPhi + y*cosPhi);
+	    
+	    Color c = g.getColor();
+	    g.setColor(color);
+	    g.drawLine(ix22,iy22,(int)x0,(int)y0);
+	    g.drawLine(ix32,iy32,(int)x0,(int)y0);
+	    g.setColor(c);
+	}
+
+
+  	/**
+  	 * Scalierbarer und dick ausgef<65>llter Pfeil 
+  	 * @param screen
+  	 * @param x
+  	 * @param y
+  	 */
+  	public final void drawFillArrow(Graphics screen, int x, int y) {
+		Graphics2D g = (Graphics2D)screen;
+		BasicStroke pen = new BasicStroke(2F,
+				BasicStroke.CAP_ROUND, BasicStroke.JOIN_MITER);
+		Polygon p = new Polygon();
+		double peakLength = 0.4;
+		double tailThickness = 0.3;
+      
+		p.addPoint(1, y/2);
+		p.addPoint((int) (x * peakLength), 1);
+		p.addPoint((int) (x * peakLength), (int) ((y - (y * tailThickness))/2));
+		p.addPoint((x-1), (int) ((y - (y * tailThickness))/2));
+      	p.addPoint((x-1), 
+      			(int) ((y - (y * tailThickness))/2 + (y * tailThickness)));
+      	p.addPoint((int) (x * peakLength), 
+      			(int) ((y - (y * tailThickness))/2 + (y * tailThickness)));
+      	p.addPoint((int) (x * peakLength), y-1);
+
+      	g.setStroke(pen);
+      	g.fillPolygon(p);
+      	g.drawPolygon(p);
+  	}
+
+}

src/awt/Banner.java

@@ -0,0 +1,47 @@
+package awt;
+
+/*************************************************************************
+ *  Compilation:  javac Banner.java
+ *  Execution:    java Banner s
+ *  Dependencies: StdDraw.java
+ *
+ *  Plots the String s, and moves it across the screen, left-to-right,
+ *  wrapping around when it reaches the border.
+ *
+ *  % java Banner "Hello, World"
+ *
+ *
+ *************************************************************************/
+
+import java.awt.Font;
+
+import stdlib.Color;
+import stdlib.StdDraw;
+
+public class Banner { 
+
+    public static void main(String[] args) { 
+//        String s = args[0];
+        String s = "Hello World";
+        StdDraw sd = new StdDraw();
+
+        // remove the 5% border
+        sd.setXscale(1.0/22.0, 21.0/22.0);
+        sd.setYscale(1.0/22.0, 21.0/22.0);
+
+        // set the font
+        Font f = new Font("Arial", Font.BOLD, 60);
+        StdDraw.setFont(f);
+        sd.setPenColor(Color.WHITE);
+
+        for (double i = 0.0; true; i += 0.01) {
+            StdDraw.clear(StdDraw.getClearColor());
+            StdDraw.text((i % 1.0),       0.5, s);
+            StdDraw.text((i % 1.0) - 1.0, 0.5, s);
+            StdDraw.text((i % 1.0) + 1.0, 0.5, s);
+            sd.show(60);
+        }
+
+    }
+
+}

src/awt/Clock.java

@@ -0,0 +1,74 @@
+package awt;
+
+import stdlib.Color;
+import stdlib.StdDraw;
+
+
+/*************************************************************************
+ *  Compilation:  javac Clock.java
+ *  Execution:    java Clock
+ *  Dependencies: StdDraw.java
+ *
+ *************************************************************************/
+
+public class Clock { 
+
+    public static void main(String[] args) { 
+    	StdDraw sd = new StdDraw();
+
+        for (int t = 0; true; t++) {
+
+            // remainder operator with doubles so all hands move every second
+            double seconds = t % 60;
+            double minutes = (t / 60.0) % 60;
+            double hours   = (t / 3600.0) % 12;
+
+            StdDraw.clear(StdDraw.getClearColor());
+            sd.setPenRadius();
+
+            // clock face
+            sd.setPenColor(Color.BLACK);
+            StdDraw.filledCircle(0.5, 0.5, 0.45);
+
+            // hour markers
+            sd.setPenColor(Color.BLUE_GREEN);
+            for (int i = 0; i < 12; i++) {
+                double theta = Math.toRadians(i * 30);
+                StdDraw.filledCircle(0.5 + 0.4 * Math.cos(theta), 0.5 + 0.4 * Math.sin(theta), .025);
+            }
+
+            // second hand
+            sd.setPenRadius(.01);
+            sd.setPenColor(Color.ORANGE);
+            double angle1 = Math.toRadians(6 * seconds);
+            double r1 = 0.4;
+            sd.line(0.5, 0.5, 0.5 + r1 * Math.sin(angle1), 0.5 + r1 * Math.cos(angle1));
+
+            // minute hand
+            sd.setPenRadius(.02);
+            sd.setPenColor(Color.DARK_GRAY);
+            double angle2 = Math.toRadians(6 * minutes);
+            double r2 = 0.3;
+            sd.line(0.5, 0.5, 0.5 + r2 * Math.sin(angle2), 0.5 + r2 * Math.cos(angle2));
+
+            // hour hand
+            sd.setPenRadius(.025);
+            sd.setPenColor(Color.GRAY);
+            double angle3 = Math.toRadians(30 * hours);
+            double r3 = 0.2;
+            sd.line(0.5, 0.5, 0.5 + r3 * Math.sin(angle3), 0.5 + r3 * Math.cos(angle3));
+
+            // digital time
+            int second = t          % 60;
+            int minute = (t / 60)   % 60;
+            int hour   = (t / 3600) % 12;
+            String time = String.format("%2d:%02d:%02d", hour, minute, second);
+            sd.setPenColor(Color.DARK_RED);
+            StdDraw.text(0.5, 0.0, time);
+
+            // 1000 miliseconds = 1 second
+            sd.show(1000);
+        }
+    }
+
+}

src/awt/Donut.java

@@ -0,0 +1,66 @@
+package awt;
+
+import java.awt.BasicStroke;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.Graphics;
+import java.awt.Graphics2D;
+import java.awt.RenderingHints;
+import java.awt.geom.AffineTransform;
+import java.awt.geom.Ellipse2D;
+
+import javax.swing.JFrame;
+import javax.swing.JPanel;
+
+
+public class Donut extends JPanel {
+	private static final long serialVersionUID = -1153356523283201001L;
+
+
+	public void paint(Graphics g) {
+
+        super.paint(g);
+
+        Graphics2D g2 = (Graphics2D)g;
+
+        RenderingHints rh = new RenderingHints(RenderingHints.KEY_ANTIALIASING,
+                RenderingHints.VALUE_ANTIALIAS_ON);
+
+        rh.put(RenderingHints.KEY_RENDERING,
+               RenderingHints.VALUE_RENDER_QUALITY);
+
+        g2.setRenderingHints(rh);
+
+        Dimension size = getSize();
+        double w = size.getWidth();
+        double h = size.getHeight();
+
+        Ellipse2D e = new Ellipse2D.Double(0, 0, 80, 130);
+        g2.setStroke(new BasicStroke(1));
+        g2.setColor(Color.gray);
+
+        AffineTransform at =
+                AffineTransform.getTranslateInstance(w / 2, h / 2);
+        for (double deg = 0; deg < 360; deg += 5) {
+            at =  AffineTransform.getTranslateInstance(w / 2, h / 2);
+            at.rotate(Math.toRadians(deg));
+            g2.draw(at.createTransformedShape(e));
+        }
+        
+
+        Ellipse2D p = new Ellipse2D.Double(0, 0, 1, 1);
+        p.setFrame(200, 200, 1, 1);
+        g2.draw(at.createTransformedShape(p));
+    }
+
+
+    public static void main(String[] args) {
+
+        JFrame frame = new JFrame("Donut");
+        frame.add(new Donut());
+        frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+        frame.setSize(370, 320);
+        frame.setLocationRelativeTo(null);
+        frame.setVisible(true);
+    }
+}

src/awt/Histogram.java

@@ -0,0 +1,54 @@
+package awt;
+
+import math.statistics.Bernoulli;
+
+/*************************************************************************
+ *  Compilation:  javac Histogram.java
+ *
+ *  This data type supports simple client code to create dynamic
+ *  histograms of the frequency of occurrence of values in [0, N).
+ *  The frequencies are kept in an instance-variable array, and
+ *  an instance variable max tracks the maximum frequency (for scaling).
+ *
+ *  % java Histogram 50 1000000 
+ *
+ *************************************************************************/
+
+public class Histogram {
+    private final double[] freq;   // freq[i] = # occurences of value i
+    private double max;            // max frequency of any value
+	Plot plot = new Plot();
+
+    // Create a new histogram. 
+    public Histogram(int N) {
+        freq = new double[N];
+    }
+
+    // Add one occurrence of the value i. 
+    public void addDataPoint(int i) {
+        freq[i]++; 
+        if (freq[i] > max) max = freq[i]; 
+    } 
+
+    // draw the histogram.
+    public void draw() {
+//        plot.setCanvasSize(500, 100);  //TODO: cause a reopen / new window
+        plot.setYscale(0, max);
+        plot.bars(freq);
+    }
+ 
+    public static void main(String[] args) {
+    	args = new String[]{"50","1000000"};
+        int N = Integer.parseInt(args[0]);   // number of coins
+        int T = Integer.parseInt(args[1]);   // number of trials
+
+        // create the histogram
+        Histogram histogram = new Histogram(N+1); 
+        for (int t = 0; t < T; t++) {
+            histogram.addDataPoint(Bernoulli.binomial(N));
+        }
+
+        // display using standard draw
+        histogram.draw();
+    } 
+} 

src/awt/Plot.java

@@ -0,0 +1,41 @@
+package awt;
+
+import stdlib.StdDraw;
+
+public class Plot extends StdDraw{
+	
+	/**
+	 * Plot points (i, a[i]) to standard draw.
+	 */
+	public void points(double[] a) {
+		int n = a.length;
+		setXscale(0, n-1);
+		setPenRadius(1.0 / (3.0 * n));
+		int i;
+		for(i=0; i<n; i++)
+			point(i, a[i]);
+	}
+
+	/**
+	 * Plot line segments connecting points (i, a[i]) to standard draw.
+	 */
+	public void lines(double[] a) {
+		int n = a.length;
+		setXscale(0, n-1);
+		setPenRadius();
+		int i;
+		for(i=1; i<n; i++) 
+			line(i-1, a[i-1], i, a[i]);
+	}
+
+	/**
+	 * Plot bars from (0, a[i]) to (i, a[i]) to standard draw.
+	 */
+	public void bars(double[] a) {
+		int N = a.length;
+		setXscale(0, N-1);
+		int i;
+		for(i=0; i<N; i++)
+			StdDraw.filledRectangle(i, a[i]/2, .25, a[i]/2);
+	}
+}

src/awt/Sierpinski.java

@@ -0,0 +1,35 @@
+package awt;
+
+import stdlib.StdDraw;
+import stdlib.StdRandom;
+
+/*************************************************************************
+ *  Compilation:  javac Sierpinski.java
+ *  Execution:    java Sierpinski N S
+ *  Dependencies: StdDraw.java
+ *
+ *  Play chaos game on triangle to produce Sierpinski triangle.
+ *  Plot N points of size S.
+ *
+ *  % java Sierpinski 10000
+ *
+ *************************************************************************/
+
+public class Sierpinski {
+
+    public static void main(String[] args) {
+//        int N = Integer.parseInt(args[0]);
+    	int N = 10000;
+        double[] cx   = { 0.000, 1.000, 0.500 }; 
+        double[] cy   = { 0.000, 0.000, 0.866 }; 
+
+        StdDraw sd = new StdDraw();
+        double x = 0.0, y = 0.0; 
+        for (int i = 0; i < N; i++) { 
+            int r = StdRandom.uniform(3);
+            x = (x + cx[r]) / 2.0; 
+            y = (y + cy[r]) / 2.0; 
+            sd.point(x, y); 
+        } 
+    }   
+}

src/awt/package-info.java

@@ -0,0 +1,6 @@
+/**
+ * AWT GUIs
+ * 
+ * @author Daniel Weschke
+ */
+package awt;

src/biology/CompactGenome.java

@@ -0,0 +1,63 @@
+package biology;
+
+/*************************************************************************
+ *  Compilation:  javac CompactGenome.java
+ *  Execution:    java CompactGenome
+ *
+ *  CHANGE TO USE CHAR ARRAY, AND PACK 8 TO THE CHAR
+ *  BOOLEAN ARRAY IN JAVA USES 4 BITS PER VALUE (INSTEAD OF ONE)
+ *
+ *************************************************************************/
+
+public class CompactGenome {
+    private boolean[] a = new boolean[2];
+    private int N = 0;
+
+
+    // double the size of the array
+    private void resize() {
+        boolean[] temp = new boolean[2*a.length];
+        for (int i = 0; i < a.length; i++) temp[i] = a[i];
+        a = temp;
+    }
+
+    public void addNucleotide(char c) {
+        if (2*N == a.length) resize();
+        if      (c == 'a')  { a[2*N] = false; a[2*N + 1] = false; }
+        else if (c == 'c')  { a[2*N] = false; a[2*N + 1] = true;  }
+        else if (c == 'g')  { a[2*N] = true;  a[2*N + 1] = false; }
+        else if (c == 't')  { a[2*N] = true;  a[2*N + 1] = true;  }
+        else throw new RuntimeException("Illegal nucleotide");
+        N++;
+    }
+
+
+    public char nucleotideAt(int i) {
+        if (i >= N || i < 0) throw new RuntimeException("Genome out of bounds");
+        if      (a[2*i] == false && a[2*i + 1] == false) return 'a';
+        else if (a[2*i] == false && a[2*i + 1] == true)  return 'c';
+        else if (a[2*i] == true  && a[2*i + 1] == false) return 'g';
+        else                                             return 't';
+    }
+
+    public int length() { return N; }
+
+
+
+    // sample client for testing
+    public static void main(String[] args) {
+        CompactGenome g = new CompactGenome();
+        g.addNucleotide('a');
+        g.addNucleotide('g');
+        g.addNucleotide('c');
+        g.addNucleotide('c');
+        g.addNucleotide('t');
+        for (int i = 0; i < g.length(); i++) {
+            System.out.print(g.nucleotideAt(i));
+        }
+        System.out.println();
+       
+
+    }
+
+}

src/biology/GeneFind.java

@@ -0,0 +1,58 @@
+package biology;
+
+import stdlib.StdIn;
+
+/*************************************************************************
+ *  Compilation:  javac GeneFind.java
+ *  Execution:    java GeneFind start stop < input.txt
+ *
+ *  To find a gene in a genome, we scan for the start codon,
+ *  remember its index, then scan from the next stop codon.
+ *  If the length of the intervening sequence is a multiple of 3,
+ *  we have found a gene.
+ *
+ *  % more genomeTiny.txt
+ *  ATAGATGCATAGCGCATAGCTAGATGTGCTAGCAT
+ *
+ *  % java GeneFind ATG TAG < genomeTiny.txt
+ *  CATAGCGCA
+ *  TGC
+ *
+ *  % java GeneFind ATG TAG < genomeVirus.txt
+ *  CGCCTGCGTCTGTAC
+ *  TCGAGCGGATCGCTCACAACCAGTCGG
+ *  AGATTATCAAAAAGGATCTTCACC
+ *
+ *************************************************************************/
+
+public class GeneFind {
+    public static void main(String[] args)  {
+
+        // read in data
+        String start = args[0];
+        String stop  = args[1];
+        String genome = StdIn.readAll();
+        System.out.println("genome = '" + genome + "'");
+        System.out.println("start  = '" + start  + "'");
+        System.out.println("stop   = '" + stop   + "'");
+
+        // find genes
+        int beg = -1;
+        for (int i = 0; i < genome.length() - 2; i++) {
+            String codon = genome.substring(i, i+3);
+
+            // start codon
+            if (codon.equals(start)) beg = i;
+
+            // stop codon
+            if ((codon.equals(stop)) && (beg != -1) && (beg + 3 < i)) {
+                // check putative gene alignment
+                String gene = genome.substring(beg+3, i);
+                if (gene.length() % 3 == 0) {
+                    System.out.println(gene);
+                    beg = -1;
+                }
+            }
+        }
+    }
+}